Incidental Mutation 'R0319:Col6a3'
ID 25519
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Name collagen, type VI, alpha 3
Synonyms Col6a-3
MMRRC Submission 038529-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0319 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 90694582-90771710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90735426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 741 (E741G)
Ref Sequence ENSEMBL: ENSMUSP00000140858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000056925
AA Change: E1348G

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: E1348G

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097653
AA Change: E741G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: E741G

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130846
AA Change: E1348G

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: E1348G

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136916
Predicted Effect possibly damaging
Transcript: ENSMUST00000188587
AA Change: E741G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: E741G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Meta Mutation Damage Score 0.2209 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 127,836,362 (GRCm39) V77G probably benign Het
Abcb1b A G 5: 8,877,428 (GRCm39) R663G probably benign Het
Acly A G 11: 100,395,808 (GRCm39) V404A probably damaging Het
Actg2 T A 6: 83,497,725 (GRCm39) I103F probably damaging Het
Anapc5 A G 5: 122,956,919 (GRCm39) V120A probably damaging Het
Ankk1 T G 9: 49,327,371 (GRCm39) T603P probably damaging Het
Ankmy2 T C 12: 36,215,898 (GRCm39) S33P possibly damaging Het
Arhgef19 A T 4: 140,983,710 (GRCm39) T748S possibly damaging Het
Atad5 T A 11: 80,011,616 (GRCm39) probably benign Het
Atxn10 T C 15: 85,249,483 (GRCm39) L105P probably damaging Het
Cacna1s T C 1: 135,998,455 (GRCm39) V161A probably damaging Het
Cpne9 G A 6: 113,271,654 (GRCm39) G338E probably damaging Het
Cyp3a13 G A 5: 137,897,124 (GRCm39) P397S probably damaging Het
Dbn1 C T 13: 55,622,729 (GRCm39) E585K probably damaging Het
Draxin A G 4: 148,200,429 (GRCm39) L7P probably benign Het
Exosc7 T A 9: 122,960,025 (GRCm39) probably benign Het
Far2 A G 6: 148,058,968 (GRCm39) E218G probably damaging Het
Ggps1 A C 13: 14,228,462 (GRCm39) N240K possibly damaging Het
Kcnip1 T C 11: 33,601,529 (GRCm39) probably benign Het
Kcnv2 A T 19: 27,301,424 (GRCm39) Y425F probably benign Het
Kdelr2 T A 5: 143,398,272 (GRCm39) F40I probably damaging Het
Kdm1b C T 13: 47,207,195 (GRCm39) P173L probably benign Het
Kif20b G A 19: 34,925,132 (GRCm39) probably benign Het
Klhl9 A T 4: 88,638,691 (GRCm39) Y517N possibly damaging Het
Lgals3bp A G 11: 118,284,347 (GRCm39) S411P probably damaging Het
Lmo3 G A 6: 138,354,309 (GRCm39) T85M probably damaging Het
Lvrn C A 18: 46,997,820 (GRCm39) T256N probably damaging Het
Malt1 T C 18: 65,595,986 (GRCm39) probably null Het
Mgst1 A G 6: 138,133,155 (GRCm39) I157V possibly damaging Het
Mob3a A T 10: 80,525,819 (GRCm39) V164E possibly damaging Het
Mprip T A 11: 59,587,864 (GRCm39) probably benign Het
Mst1 A G 9: 107,959,712 (GRCm39) N276S probably benign Het
Or5an1b A T 19: 12,299,680 (GRCm39) C170* probably null Het
P3h2 T A 16: 25,789,681 (GRCm39) I529F possibly damaging Het
Pikfyve T A 1: 65,285,490 (GRCm39) S865T probably benign Het
Rcbtb2 G A 14: 73,415,909 (GRCm39) R474Q probably benign Het
Rpl27 G A 11: 101,334,321 (GRCm39) probably benign Het
Rtp1 G A 16: 23,250,210 (GRCm39) E192K probably damaging Het
Sgk2 T C 2: 162,837,592 (GRCm39) probably benign Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc49a4 T C 16: 35,570,884 (GRCm39) D140G probably benign Het
Spdl1 T C 11: 34,714,347 (GRCm39) N114S possibly damaging Het
Syne2 C T 12: 76,110,936 (GRCm39) R5756W probably damaging Het
Tor1aip1 T C 1: 155,882,927 (GRCm39) E307G probably damaging Het
Tpd52 T C 3: 9,018,749 (GRCm39) T44A probably benign Het
Trim67 A T 8: 125,549,966 (GRCm39) Y532F probably damaging Het
Ttll9 C A 2: 152,842,018 (GRCm39) probably null Het
Ush2a T C 1: 188,680,571 (GRCm39) probably benign Het
Vcam1 T C 3: 115,909,709 (GRCm39) I539M probably benign Het
Vmn1r19 T A 6: 57,381,600 (GRCm39) M51K possibly damaging Het
Vmn2r61 T A 7: 41,949,941 (GRCm39) M787K probably damaging Het
Xdh T A 17: 74,213,096 (GRCm39) probably benign Het
Zfp109 A T 7: 23,933,895 (GRCm39) V8E probably damaging Het
Zfp595 G A 13: 67,464,577 (GRCm39) A562V possibly damaging Het
Zfp759 A G 13: 67,288,356 (GRCm39) T636A probably benign Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90,755,977 (GRCm39) missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90,709,748 (GRCm39) missense unknown
IGL00541:Col6a3 APN 1 90,729,864 (GRCm39) missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90,730,054 (GRCm39) missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90,731,655 (GRCm39) missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90,735,232 (GRCm39) missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90,730,014 (GRCm39) missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90,730,236 (GRCm39) missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90,706,884 (GRCm39) missense unknown
IGL01827:Col6a3 APN 1 90,730,041 (GRCm39) missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90,724,293 (GRCm39) missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90,700,770 (GRCm39) missense unknown
IGL01900:Col6a3 APN 1 90,722,732 (GRCm39) critical splice donor site probably null
IGL01925:Col6a3 APN 1 90,729,958 (GRCm39) missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90,709,858 (GRCm39) splice site probably benign
IGL02115:Col6a3 APN 1 90,735,373 (GRCm39) missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90,709,482 (GRCm39) missense unknown
IGL02313:Col6a3 APN 1 90,739,328 (GRCm39) missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90,706,919 (GRCm39) missense unknown
IGL02821:Col6a3 APN 1 90,731,600 (GRCm39) missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90,724,281 (GRCm39) missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90,739,242 (GRCm39) nonsense probably null
IGL03129:Col6a3 APN 1 90,749,584 (GRCm39) missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90,731,615 (GRCm39) missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90,755,588 (GRCm39) missense probably benign 0.33
IGL03251:Col6a3 APN 1 90,737,898 (GRCm39) missense probably damaging 1.00
bailey UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
barnum UTSW 1 90,706,874 (GRCm39) missense unknown
Boneless UTSW 1 90,706,781 (GRCm39) missense unknown
Noodloid UTSW 1 90,707,011 (GRCm39) missense unknown
randolf UTSW 1 90,715,673 (GRCm39) missense unknown
stringy UTSW 1 90,731,400 (GRCm39) nonsense probably null
wonder UTSW 1 90,719,645 (GRCm39) critical splice donor site probably null
ANU05:Col6a3 UTSW 1 90,730,014 (GRCm39) missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90,737,970 (GRCm39) missense possibly damaging 0.58
PIT4810001:Col6a3 UTSW 1 90,706,516 (GRCm39) missense unknown
R0020:Col6a3 UTSW 1 90,739,272 (GRCm39) missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90,739,272 (GRCm39) missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90,729,967 (GRCm39) missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90,729,967 (GRCm39) missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90,725,883 (GRCm39) missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90,741,273 (GRCm39) missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90,725,895 (GRCm39) missense probably damaging 1.00
R0348:Col6a3 UTSW 1 90,755,771 (GRCm39) missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90,715,938 (GRCm39) missense unknown
R0512:Col6a3 UTSW 1 90,749,520 (GRCm39) intron probably benign
R0564:Col6a3 UTSW 1 90,735,456 (GRCm39) missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90,735,808 (GRCm39) splice site probably null
R0667:Col6a3 UTSW 1 90,755,823 (GRCm39) missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90,706,703 (GRCm39) missense unknown
R0736:Col6a3 UTSW 1 90,731,811 (GRCm39) missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90,756,020 (GRCm39) missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90,730,375 (GRCm39) missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90,722,047 (GRCm39) missense probably null 1.00
R1169:Col6a3 UTSW 1 90,749,736 (GRCm39) missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90,709,577 (GRCm39) missense unknown
R1225:Col6a3 UTSW 1 90,739,238 (GRCm39) missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90,696,069 (GRCm39) missense unknown
R1387:Col6a3 UTSW 1 90,750,138 (GRCm39) intron probably benign
R1437:Col6a3 UTSW 1 90,729,098 (GRCm39) missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90,709,577 (GRCm39) missense unknown
R1677:Col6a3 UTSW 1 90,749,583 (GRCm39) missense probably benign 0.14
R1681:Col6a3 UTSW 1 90,701,224 (GRCm39) missense unknown
R1711:Col6a3 UTSW 1 90,757,935 (GRCm39) missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90,724,296 (GRCm39) critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90,706,781 (GRCm39) missense unknown
R1738:Col6a3 UTSW 1 90,744,083 (GRCm39) missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90,741,516 (GRCm39) missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90,755,671 (GRCm39) missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90,735,256 (GRCm39) missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90,735,256 (GRCm39) missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90,757,936 (GRCm39) missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90,731,433 (GRCm39) missense probably benign 0.00
R1895:Col6a3 UTSW 1 90,731,433 (GRCm39) missense probably benign 0.00
R1908:Col6a3 UTSW 1 90,739,421 (GRCm39) missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90,750,081 (GRCm39) missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90,731,897 (GRCm39) missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90,709,733 (GRCm39) missense unknown
R2121:Col6a3 UTSW 1 90,738,087 (GRCm39) missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90,731,467 (GRCm39) missense probably benign 0.09
R2448:Col6a3 UTSW 1 90,741,080 (GRCm39) missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90,731,435 (GRCm39) missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90,703,321 (GRCm39) missense unknown
R3052:Col6a3 UTSW 1 90,729,852 (GRCm39) missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90,744,024 (GRCm39) missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90,744,024 (GRCm39) missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90,744,024 (GRCm39) missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90,731,813 (GRCm39) missense probably benign 0.42
R3419:Col6a3 UTSW 1 90,731,813 (GRCm39) missense probably benign 0.42
R3837:Col6a3 UTSW 1 90,707,803 (GRCm39) missense unknown
R4007:Col6a3 UTSW 1 90,730,291 (GRCm39) missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90,749,605 (GRCm39) missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90,735,336 (GRCm39) missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90,729,105 (GRCm39) missense probably benign 0.28
R4244:Col6a3 UTSW 1 90,714,361 (GRCm39) missense unknown
R4297:Col6a3 UTSW 1 90,739,100 (GRCm39) missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90,735,336 (GRCm39) missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90,749,736 (GRCm39) missense probably benign 0.23
R4600:Col6a3 UTSW 1 90,709,626 (GRCm39) missense unknown
R4683:Col6a3 UTSW 1 90,701,179 (GRCm39) missense unknown
R4788:Col6a3 UTSW 1 90,700,672 (GRCm39) critical splice donor site probably null
R4851:Col6a3 UTSW 1 90,707,011 (GRCm39) missense unknown
R4899:Col6a3 UTSW 1 90,730,149 (GRCm39) missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90,729,164 (GRCm39) missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90,735,246 (GRCm39) missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90,731,940 (GRCm39) missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90,706,565 (GRCm39) missense unknown
R5057:Col6a3 UTSW 1 90,743,852 (GRCm39) missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90,707,074 (GRCm39) missense unknown
R5105:Col6a3 UTSW 1 90,725,862 (GRCm39) missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90,696,067 (GRCm39) missense unknown
R5166:Col6a3 UTSW 1 90,738,330 (GRCm39) missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90,701,361 (GRCm39) nonsense probably null
R5196:Col6a3 UTSW 1 90,744,260 (GRCm39) splice site probably null
R5230:Col6a3 UTSW 1 90,716,776 (GRCm39) missense unknown
R5268:Col6a3 UTSW 1 90,712,965 (GRCm39) missense unknown
R5381:Col6a3 UTSW 1 90,703,334 (GRCm39) missense unknown
R5392:Col6a3 UTSW 1 90,729,017 (GRCm39) missense probably benign 0.41
R5445:Col6a3 UTSW 1 90,709,761 (GRCm39) nonsense probably null
R5571:Col6a3 UTSW 1 90,715,938 (GRCm39) missense unknown
R5665:Col6a3 UTSW 1 90,755,602 (GRCm39) missense probably benign 0.00
R5902:Col6a3 UTSW 1 90,729,921 (GRCm39) splice site probably null
R5914:Col6a3 UTSW 1 90,703,922 (GRCm39) missense unknown
R5955:Col6a3 UTSW 1 90,739,163 (GRCm39) missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90,749,571 (GRCm39) missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90,696,105 (GRCm39) missense unknown
R6010:Col6a3 UTSW 1 90,701,219 (GRCm39) missense unknown
R6025:Col6a3 UTSW 1 90,755,824 (GRCm39) missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90,741,475 (GRCm39) missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90,701,387 (GRCm39) missense unknown
R6181:Col6a3 UTSW 1 90,744,096 (GRCm39) missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90,750,063 (GRCm39) missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90,749,955 (GRCm39) missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90,738,285 (GRCm39) missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90,709,534 (GRCm39) missense unknown
R6484:Col6a3 UTSW 1 90,719,645 (GRCm39) critical splice donor site probably null
R6701:Col6a3 UTSW 1 90,720,184 (GRCm39) missense probably benign 0.14
R6702:Col6a3 UTSW 1 90,707,161 (GRCm39) missense unknown
R6703:Col6a3 UTSW 1 90,720,184 (GRCm39) missense probably benign 0.14
R6703:Col6a3 UTSW 1 90,707,161 (GRCm39) missense unknown
R6724:Col6a3 UTSW 1 90,706,874 (GRCm39) missense unknown
R6746:Col6a3 UTSW 1 90,706,767 (GRCm39) missense unknown
R6797:Col6a3 UTSW 1 90,731,810 (GRCm39) missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90,722,731 (GRCm39) splice site probably null
R6903:Col6a3 UTSW 1 90,721,929 (GRCm39) missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90,743,724 (GRCm39) missense probably benign 0.00
R6978:Col6a3 UTSW 1 90,735,192 (GRCm39) critical splice donor site probably null
R7058:Col6a3 UTSW 1 90,755,759 (GRCm39) nonsense probably null
R7182:Col6a3 UTSW 1 90,731,400 (GRCm39) nonsense probably null
R7294:Col6a3 UTSW 1 90,756,005 (GRCm39) missense probably damaging 1.00
R7296:Col6a3 UTSW 1 90,755,708 (GRCm39) missense probably benign 0.00
R7311:Col6a3 UTSW 1 90,750,013 (GRCm39) missense probably damaging 1.00
R7412:Col6a3 UTSW 1 90,755,855 (GRCm39) missense probably damaging 0.98
R7561:Col6a3 UTSW 1 90,703,463 (GRCm39) missense unknown
R7575:Col6a3 UTSW 1 90,738,321 (GRCm39) missense possibly damaging 0.92
R7659:Col6a3 UTSW 1 90,709,467 (GRCm39) missense unknown
R7679:Col6a3 UTSW 1 90,739,473 (GRCm39) missense possibly damaging 0.49
R7831:Col6a3 UTSW 1 90,724,268 (GRCm39) nonsense probably null
R7855:Col6a3 UTSW 1 90,738,343 (GRCm39) missense possibly damaging 0.57
R7990:Col6a3 UTSW 1 90,709,577 (GRCm39) missense unknown
R8003:Col6a3 UTSW 1 90,703,455 (GRCm39) missense unknown
R8007:Col6a3 UTSW 1 90,705,179 (GRCm39) missense unknown
R8098:Col6a3 UTSW 1 90,731,383 (GRCm39) missense probably benign
R8312:Col6a3 UTSW 1 90,741,412 (GRCm39) missense possibly damaging 0.55
R8419:Col6a3 UTSW 1 90,729,935 (GRCm39) missense probably damaging 1.00
R8723:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8725:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8737:Col6a3 UTSW 1 90,727,747 (GRCm39) missense probably benign 0.10
R8742:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8743:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8744:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8753:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8754:Col6a3 UTSW 1 90,695,328 (GRCm39) critical splice acceptor site probably benign
R8773:Col6a3 UTSW 1 90,696,171 (GRCm39) missense unknown
R8857:Col6a3 UTSW 1 90,703,485 (GRCm39) missense unknown
R8867:Col6a3 UTSW 1 90,715,673 (GRCm39) missense unknown
R8887:Col6a3 UTSW 1 90,755,948 (GRCm39) missense probably benign
R9011:Col6a3 UTSW 1 90,710,057 (GRCm39) splice site probably benign
R9049:Col6a3 UTSW 1 90,707,066 (GRCm39) missense unknown
R9142:Col6a3 UTSW 1 90,706,566 (GRCm39) missense unknown
R9155:Col6a3 UTSW 1 90,738,301 (GRCm39) missense probably benign 0.27
R9249:Col6a3 UTSW 1 90,707,020 (GRCm39) missense unknown
R9258:Col6a3 UTSW 1 90,700,703 (GRCm39) missense unknown
R9274:Col6a3 UTSW 1 90,707,020 (GRCm39) missense unknown
R9276:Col6a3 UTSW 1 90,735,403 (GRCm39) missense possibly damaging 0.94
R9315:Col6a3 UTSW 1 90,738,979 (GRCm39) critical splice donor site probably null
R9376:Col6a3 UTSW 1 90,709,523 (GRCm39) missense unknown
R9377:Col6a3 UTSW 1 90,743,961 (GRCm39) missense probably damaging 1.00
R9429:Col6a3 UTSW 1 90,731,585 (GRCm39) missense probably benign 0.01
R9439:Col6a3 UTSW 1 90,744,155 (GRCm39) missense probably damaging 1.00
R9440:Col6a3 UTSW 1 90,707,068 (GRCm39) missense unknown
R9441:Col6a3 UTSW 1 90,705,249 (GRCm39) nonsense probably null
R9477:Col6a3 UTSW 1 90,706,621 (GRCm39) missense unknown
R9498:Col6a3 UTSW 1 90,713,650 (GRCm39) nonsense probably null
R9528:Col6a3 UTSW 1 90,731,789 (GRCm39) missense probably damaging 1.00
R9602:Col6a3 UTSW 1 90,731,497 (GRCm39) missense probably benign 0.07
RF005:Col6a3 UTSW 1 90,738,984 (GRCm39) missense probably benign 0.00
RF012:Col6a3 UTSW 1 90,738,282 (GRCm39) missense probably damaging 1.00
X0024:Col6a3 UTSW 1 90,731,359 (GRCm39) critical splice donor site probably null
X0063:Col6a3 UTSW 1 90,731,627 (GRCm39) missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90,739,251 (GRCm39) missense probably damaging 1.00
Z1177:Col6a3 UTSW 1 90,739,450 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TATGGGGAGATGTGCTCAGCCTAC -3'
(R):5'- TGAATGCCCACTTCAGCAAGGATG -3'

Sequencing Primer
(F):5'- cccacccccacccctac -3'
(R):5'- CACTTCAGCAAGGATGAAGTACAG -3'
Posted On 2013-04-16