Mutagenetix > Incidental Mutation

Incidental Mutation 'R2942:Pth2r'

255190

Institutional Source

Beutler Lab

Gene Symbol

Pth2r

Ensembl Gene

ENSMUSG00000025946

Gene Name

parathyroid hormone 2 receptor

Synonyms

Pthr2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2942 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65321215-65428403 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 65427635 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 436 (R436K)

Ref Sequence

ENSEMBL: ENSMUSP00000027083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027083]

AlphaFold

Q91V95

Predicted Effect

probably benign
Transcript: ENSMUST00000027083
AA Change: R436K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000027083
Gene: ENSMUSG00000025946
AA Change: R436K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
HormR	59	134	8.15e-28	SMART
Pfam:7tm_2	139	406	5.1e-81	PFAM
low complexity region	447	461	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 9 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	G	T	1: 58,376,540 (GRCm39)	R907L	probably benign	Het
Fat4	A	G	3: 39,036,485 (GRCm39)	N3379S	probably damaging	Het
Kcnv1	A	G	15: 44,972,581 (GRCm39)	F434S	probably damaging	Het
Parg	A	G	14: 31,931,294 (GRCm39)	K305E	probably damaging	Het
Phlpp1	G	A	1: 106,100,502 (GRCm39)	V257I	probably benign	Het
Srsf9	T	C	5: 115,470,752 (GRCm39)	Y215H	probably damaging	Het
Tjp1	A	G	7: 64,967,754 (GRCm39)	V798A	probably damaging	Het
Trmt13	A	T	3: 116,379,421 (GRCm39)	I242N	probably damaging	Het
Vmn1r31	G	A	6: 58,449,583 (GRCm39)	T94I	possibly damaging	Het

Other mutations in Pth2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Pth2r	APN	1	65,427,884 (GRCm39)	missense	probably benign	0.08
IGL02054:Pth2r	APN	1	65,375,940 (GRCm39)	missense	probably damaging	1.00
IGL02429:Pth2r	APN	1	65,385,998 (GRCm39)	missense	probably benign	0.05
R0277:Pth2r	UTSW	1	65,427,775 (GRCm39)	missense	probably benign
R0323:Pth2r	UTSW	1	65,427,775 (GRCm39)	missense	probably benign
R0415:Pth2r	UTSW	1	65,427,598 (GRCm39)	missense	probably benign
R1067:Pth2r	UTSW	1	65,411,507 (GRCm39)	missense	possibly damaging	0.92
R1463:Pth2r	UTSW	1	65,402,436 (GRCm39)	missense	probably damaging	0.96
R1566:Pth2r	UTSW	1	65,427,697 (GRCm39)	missense	possibly damaging	0.50
R1690:Pth2r	UTSW	1	65,411,462 (GRCm39)	missense	probably benign	0.02
R1710:Pth2r	UTSW	1	65,375,997 (GRCm39)	missense	possibly damaging	0.48
R1957:Pth2r	UTSW	1	65,411,514 (GRCm39)	missense	probably damaging	1.00
R2062:Pth2r	UTSW	1	65,382,721 (GRCm39)	missense	probably damaging	1.00
R2232:Pth2r	UTSW	1	65,375,928 (GRCm39)	missense	probably damaging	1.00
R3011:Pth2r	UTSW	1	65,376,147 (GRCm39)	missense	probably benign	0.05
R3857:Pth2r	UTSW	1	65,361,206 (GRCm39)	missense	probably damaging	0.98
R3858:Pth2r	UTSW	1	65,361,206 (GRCm39)	missense	probably damaging	0.98
R3859:Pth2r	UTSW	1	65,361,206 (GRCm39)	missense	probably damaging	0.98
R4540:Pth2r	UTSW	1	65,321,360 (GRCm39)	missense	probably benign
R4694:Pth2r	UTSW	1	65,375,920 (GRCm39)	missense	probably benign
R4777:Pth2r	UTSW	1	65,427,676 (GRCm39)	missense	possibly damaging	0.90
R4926:Pth2r	UTSW	1	65,361,143 (GRCm39)	missense	probably benign	0.27
R5209:Pth2r	UTSW	1	65,427,856 (GRCm39)	missense	probably benign	0.04
R5871:Pth2r	UTSW	1	65,427,796 (GRCm39)	missense	probably damaging	1.00
R6868:Pth2r	UTSW	1	65,427,638 (GRCm39)	missense	probably benign	0.02
R7132:Pth2r	UTSW	1	65,361,225 (GRCm39)	missense	probably benign	0.00
R7242:Pth2r	UTSW	1	65,427,779 (GRCm39)	missense	probably benign	0.42
R7677:Pth2r	UTSW	1	65,427,605 (GRCm39)	missense	probably benign	0.00
R7836:Pth2r	UTSW	1	65,390,722 (GRCm39)	missense	probably damaging	1.00
R8061:Pth2r	UTSW	1	65,382,660 (GRCm39)	missense	possibly damaging	0.64
Z1176:Pth2r	UTSW	1	65,402,467 (GRCm39)	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- AAAGGCTTTTGAGGTGTATGGAAC -3'
(R):5'- AGTCCTGCTCAGAACTACTCC -3'

Sequencing Primer
(F):5'- CACAGATCTGAAGAGTCCCTGG -3'
(R):5'- TCCAGACATAGCCAGGTAGAGTC -3'

Posted On

2014-12-29