Mutagenetix > Incidental Mutation

Incidental Mutation 'R2942:Srsf9'

255196

Institutional Source

Beutler Lab

Gene Symbol

Srsf9

Ensembl Gene

ENSMUSG00000029538

Gene Name

serine and arginine-rich splicing factor 9

Synonyms

2610029M16Rik, SRp30c, Sfrs9

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.485) question?

Stock #

R2942 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115465236-115471139 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115470752 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 215 (Y215H)

Ref Sequence

ENSEMBL: ENSMUSP00000031513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031513] [ENSMUST00000139167] [ENSMUST00000149510]

AlphaFold

Q9D0B0

PDB Structure

Solution structure of RRM domain in protein BAB31986 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031513
AA Change: Y215H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000031513
Gene: ENSMUSG00000029538
AA Change: Y215H

Domain	Start	End	E-Value	Type
RRM	16	86	3.76e-19	SMART
RRM	113	179	1.19e-7	SMART
low complexity region	187	207	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139167

SMART Domains

Protein: ENSMUSP00000115090
Gene: ENSMUSG00000029536

Domain	Start	End	E-Value	Type
Pfam:Glu-tRNAGln	69	134	2e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142318

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144000

Predicted Effect

probably benign
Transcript: ENSMUST00000149510
AA Change: Y151H

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000121845
Gene: ENSMUSG00000029538
AA Change: Y151H

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
RRM	54	115	3.04e-2	SMART
low complexity region	123	143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209604

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 9 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	G	T	1: 58,376,540 (GRCm39)	R907L	probably benign	Het
Fat4	A	G	3: 39,036,485 (GRCm39)	N3379S	probably damaging	Het
Kcnv1	A	G	15: 44,972,581 (GRCm39)	F434S	probably damaging	Het
Parg	A	G	14: 31,931,294 (GRCm39)	K305E	probably damaging	Het
Phlpp1	G	A	1: 106,100,502 (GRCm39)	V257I	probably benign	Het
Pth2r	G	A	1: 65,427,635 (GRCm39)	R436K	probably benign	Het
Tjp1	A	G	7: 64,967,754 (GRCm39)	V798A	probably damaging	Het
Trmt13	A	T	3: 116,379,421 (GRCm39)	I242N	probably damaging	Het
Vmn1r31	G	A	6: 58,449,583 (GRCm39)	T94I	possibly damaging	Het

Other mutations in Srsf9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01462:Srsf9	APN	5	115,470,187 (GRCm39)	missense	probably damaging	1.00
R0137:Srsf9	UTSW	5	115,470,260 (GRCm39)	missense	possibly damaging	0.64
R0603:Srsf9	UTSW	5	115,470,696 (GRCm39)	missense	probably damaging	0.99
R1565:Srsf9	UTSW	5	115,465,429 (GRCm39)	missense	possibly damaging	0.73
R1781:Srsf9	UTSW	5	115,465,481 (GRCm39)	nonsense	probably null
R3622:Srsf9	UTSW	5	115,468,571 (GRCm39)	missense	probably damaging	0.98
R3689:Srsf9	UTSW	5	115,465,387 (GRCm39)	missense	probably benign	0.00
R4492:Srsf9	UTSW	5	115,470,651 (GRCm39)	missense	probably damaging	1.00
R5345:Srsf9	UTSW	5	115,468,595 (GRCm39)	missense	probably benign	0.03
R5840:Srsf9	UTSW	5	115,469,524 (GRCm39)	missense	probably benign
R6355:Srsf9	UTSW	5	115,465,368 (GRCm39)	start codon destroyed	probably null	0.04
R7207:Srsf9	UTSW	5	115,465,481 (GRCm39)	nonsense	probably null
R7672:Srsf9	UTSW	5	115,468,619 (GRCm39)	missense	probably damaging	1.00
R8466:Srsf9	UTSW	5	115,465,492 (GRCm39)	missense	probably benign	0.40
R8871:Srsf9	UTSW	5	115,468,712 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGCCAGGCACACAGTGAG -3'
(R):5'- CTGCTAGTATGGTGGCTCTAGC -3'

Sequencing Primer
(F):5'- ACAGTGAGTGCCAGGGCTG -3'
(R):5'- GCTCTAGCCGAAATTATGTAGTTCC -3'

Posted On

2014-12-29