Incidental Mutation 'R2942:Vmn1r31'
ID 255197
Institutional Source Beutler Lab
Gene Symbol Vmn1r31
Ensembl Gene ENSMUSG00000115404
Gene Name vomeronasal 1 receptor 31
Synonyms Gm6709
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R2942 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 58470941-58475330 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58472598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 94 (T94I)
Ref Sequence ENSEMBL: ENSMUSP00000153749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176023] [ENSMUST00000176147] [ENSMUST00000176177] [ENSMUST00000177318] [ENSMUST00000226390] [ENSMUST00000228586]
AlphaFold H3BKW5
Predicted Effect possibly damaging
Transcript: ENSMUST00000176023
AA Change: T45I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135252
Gene: ENSMUSG00000115404
AA Change: T45I

DomainStartEndE-ValueType
Pfam:V1R 1 58 1.9e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176147
AA Change: T45I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135282
Gene: ENSMUSG00000115404
AA Change: T45I

DomainStartEndE-ValueType
Pfam:V1R 1 58 1.9e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176177
AA Change: T94I

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135472
Gene: ENSMUSG00000093379
AA Change: T94I

DomainStartEndE-ValueType
Pfam:V1R 28 293 4.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177318
AA Change: T94I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135555
Gene: ENSMUSG00000115404
AA Change: T94I

DomainStartEndE-ValueType
Pfam:V1R 28 107 1.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204999
Predicted Effect possibly damaging
Transcript: ENSMUST00000226390
AA Change: T94I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228586
AA Change: T94I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox2 G T 1: 58,337,381 R907L probably benign Het
Fat4 A G 3: 38,982,336 N3379S probably damaging Het
Kcnv1 A G 15: 45,109,185 F434S probably damaging Het
Parg A G 14: 32,209,337 K305E probably damaging Het
Phlpp1 G A 1: 106,172,772 V257I probably benign Het
Pth2r G A 1: 65,388,476 R436K probably benign Het
Srsf9 T C 5: 115,332,693 Y215H probably damaging Het
Tjp1 A G 7: 65,318,006 V798A probably damaging Het
Trmt13 A T 3: 116,585,772 I242N probably damaging Het
Other mutations in Vmn1r31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Vmn1r31 APN 6 58472799 missense probably benign 0.06
IGL01386:Vmn1r31 APN 6 58472602 missense probably benign 0.22
IGL01785:Vmn1r31 APN 6 58472724 missense possibly damaging 0.95
IGL02527:Vmn1r31 APN 6 58472793 missense probably benign 0.01
PIT4791001:Vmn1r31 UTSW 6 58472043 missense probably damaging 0.97
R0107:Vmn1r31 UTSW 6 58472743 missense probably benign 0.05
R1250:Vmn1r31 UTSW 6 58472658 missense probably benign 0.01
R1616:Vmn1r31 UTSW 6 58472058 missense probably damaging 0.97
R1883:Vmn1r31 UTSW 6 58472044 missense probably damaging 0.97
R1884:Vmn1r31 UTSW 6 58472044 missense probably damaging 0.97
R4589:Vmn1r31 UTSW 6 58472611 missense probably damaging 1.00
R4672:Vmn1r31 UTSW 6 58472071 missense probably damaging 0.97
R4676:Vmn1r31 UTSW 6 58472013 missense probably damaging 0.97
R4702:Vmn1r31 UTSW 6 58471968 makesense probably null
R4703:Vmn1r31 UTSW 6 58471968 makesense probably null
R4705:Vmn1r31 UTSW 6 58471968 makesense probably null
R6341:Vmn1r31 UTSW 6 58472010 missense probably benign 0.35
R6549:Vmn1r31 UTSW 6 58472663 missense possibly damaging 0.92
R7238:Vmn1r31 UTSW 6 58472873 missense
R7609:Vmn1r31 UTSW 6 58472470 missense probably damaging 0.97
R8438:Vmn1r31 UTSW 6 58472661 missense
R8936:Vmn1r31 UTSW 6 58472098 missense unknown
R9103:Vmn1r31 UTSW 6 58472088 missense unknown
Z1176:Vmn1r31 UTSW 6 58472391 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTGACCTGCATCTGGTTATTC -3'
(R):5'- TGGAGCCTTAGCCAATATGTTTC -3'

Sequencing Primer
(F):5'- TCTCACTCACATTAGTAAAACCATG -3'
(R):5'- AGACCTAAACCTACAGACTTGATCTC -3'
Posted On 2014-12-29