Incidental Mutation 'R2970:Aff3'
ID255202
Institutional Source Beutler Lab
Gene Symbol Aff3
Ensembl Gene ENSMUSG00000037138
Gene NameAF4/FMR2 family, member 3
SynonymsLaf4, LAF-4, 3222402O04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2970 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location38177326-38664955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38535022 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 253 (S253P)
Ref Sequence ENSEMBL: ENSMUSP00000092637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039827] [ENSMUST00000095027] [ENSMUST00000134963] [ENSMUST00000212668]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027250
SMART Domains Protein: ENSMUSP00000027250
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 171 2.7e-48 PFAM
Pfam:AF-4 159 350 2.6e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000039827
AA Change: S253P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044128
Gene: ENSMUSG00000037138
AA Change: S253P

DomainStartEndE-ValueType
Pfam:AF-4 20 170 4.9e-63 PFAM
Pfam:AF-4 160 1226 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095027
AA Change: S253P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092637
Gene: ENSMUSG00000037138
AA Change: S253P

DomainStartEndE-ValueType
Pfam:AF-4 20 172 1.7e-47 PFAM
Pfam:AF-4 161 1226 3.8e-268 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134963
Predicted Effect probably benign
Transcript: ENSMUST00000212668
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tissue-restricted nuclear transcriptional activator that is preferentially expressed in lymphoid tissue. Isolation of this protein initially defined a highly conserved LAF4/MLLT2 gene family of nuclear transcription factors that may function in lymphoid development and oncogenesis. In some ALL patients, this gene has been found fused to the gene for MLL. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 A T 18: 6,111,732 S211T probably damaging Het
Ccdc186 T G 19: 56,806,998 N416H probably damaging Het
Dusp27 C T 1: 166,099,229 S938N probably benign Het
Eipr1 A T 12: 28,847,594 I152F probably benign Het
Enpp7 T C 11: 118,990,646 S206P probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nipbl C A 15: 8,311,239 C1999F probably damaging Het
Olfr1029 T C 2: 85,976,110 I289T possibly damaging Het
Olfr65 T C 7: 103,907,312 V291A probably benign Het
Olfr961 T C 9: 39,646,899 Y58H probably damaging Het
Pcnx2 A C 8: 125,801,536 L1315R probably damaging Het
Ric1 A G 19: 29,577,718 T411A probably benign Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc10a5 C A 3: 10,335,067 G178W probably damaging Het
Spam1 A T 6: 24,796,725 N225I probably damaging Het
St7 A T 6: 17,844,909 E132V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trbv13-1 A G 6: 41,116,376 K81R possibly damaging Het
Trp53bp2 T C 1: 182,431,598 L72P probably damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r71 T C 7: 10,748,714 T16A possibly damaging Het
Other mutations in Aff3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Aff3 APN 1 38535681 missense probably damaging 1.00
IGL02263:Aff3 APN 1 38535599 missense probably damaging 1.00
IGL02962:Aff3 APN 1 38535656 missense probably damaging 1.00
IGL03003:Aff3 APN 1 38209570 missense probably damaging 1.00
IGL03180:Aff3 APN 1 38535662 missense probably damaging 1.00
IGL03389:Aff3 APN 1 38210349 missense possibly damaging 0.62
PIT4377001:Aff3 UTSW 1 38538963 missense probably damaging 0.99
PIT4544001:Aff3 UTSW 1 38210362 missense probably benign 0.01
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0026:Aff3 UTSW 1 38203893 missense probably benign 0.00
R0279:Aff3 UTSW 1 38535569 missense probably damaging 1.00
R0344:Aff3 UTSW 1 38203932 missense probably benign
R0375:Aff3 UTSW 1 38204940 missense possibly damaging 0.46
R0605:Aff3 UTSW 1 38209987 missense probably damaging 1.00
R0613:Aff3 UTSW 1 38209923 missense probably benign 0.09
R0742:Aff3 UTSW 1 38627108 missense probably damaging 0.99
R1156:Aff3 UTSW 1 38204910 missense probably benign
R1255:Aff3 UTSW 1 38204884 splice site probably null
R1448:Aff3 UTSW 1 38191283 missense probably damaging 1.00
R1760:Aff3 UTSW 1 38329864 splice site probably benign
R1780:Aff3 UTSW 1 38535702 missense probably damaging 1.00
R1855:Aff3 UTSW 1 38210304 missense probably benign 0.23
R2011:Aff3 UTSW 1 38207915 missense probably benign 0.01
R2331:Aff3 UTSW 1 38204890 splice site probably null
R2965:Aff3 UTSW 1 38209710 missense probably damaging 1.00
R3015:Aff3 UTSW 1 38210568 missense probably benign 0.00
R3763:Aff3 UTSW 1 38252689 splice site probably benign
R4174:Aff3 UTSW 1 38207927 missense probably damaging 0.96
R4436:Aff3 UTSW 1 38209687 missense possibly damaging 0.75
R4661:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R5069:Aff3 UTSW 1 38181613 critical splice donor site probably null
R5566:Aff3 UTSW 1 38181424 missense probably damaging 1.00
R6023:Aff3 UTSW 1 38218370 missense probably damaging 1.00
R6209:Aff3 UTSW 1 38193589 missense probably benign 0.28
R6467:Aff3 UTSW 1 38208017 missense probably benign 0.25
R6748:Aff3 UTSW 1 38535246 missense probably damaging 1.00
R6862:Aff3 UTSW 1 38406497 missense possibly damaging 0.87
R6880:Aff3 UTSW 1 38535162 missense probably damaging 0.99
R6880:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R7187:Aff3 UTSW 1 38218397 missense probably damaging 0.98
R8322:Aff3 UTSW 1 38181661 missense possibly damaging 0.65
R8329:Aff3 UTSW 1 38205054 missense probably benign 0.13
R8737:Aff3 UTSW 1 38269729 missense probably damaging 1.00
Z1176:Aff3 UTSW 1 38329872 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGAATCTTACCACATCGCTGGG -3'
(R):5'- CAATATGGAGACGGGGCTTC -3'

Sequencing Primer
(F):5'- CATCGCTGGGGAGATGGG -3'
(R):5'- TTCAGACCCAGGAGAGGC -3'
Posted On2014-12-29