Incidental Mutation 'R2970:Olfr1029'
ID255205
Institutional Source Beutler Lab
Gene Symbol Olfr1029
Ensembl Gene ENSMUSG00000059873
Gene Nameolfactory receptor 1029
SynonymsGA_x6K02T2Q125-47454152-47455126, MOR198-1P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2970 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85973895-85978913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85976110 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 289 (I289T)
Ref Sequence ENSEMBL: ENSMUSP00000150637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056849] [ENSMUST00000082191] [ENSMUST00000217244]
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082191
AA Change: I289T

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080828
Gene: ENSMUSG00000059873
AA Change: I289T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7tm_1 41 290 2.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217244
AA Change: I289T

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 A G 1: 38,535,022 S253P probably damaging Het
Arhgap12 A T 18: 6,111,732 S211T probably damaging Het
Ccdc186 T G 19: 56,806,998 N416H probably damaging Het
Dusp27 C T 1: 166,099,229 S938N probably benign Het
Eipr1 A T 12: 28,847,594 I152F probably benign Het
Enpp7 T C 11: 118,990,646 S206P probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nipbl C A 15: 8,311,239 C1999F probably damaging Het
Olfr65 T C 7: 103,907,312 V291A probably benign Het
Olfr961 T C 9: 39,646,899 Y58H probably damaging Het
Pcnx2 A C 8: 125,801,536 L1315R probably damaging Het
Ric1 A G 19: 29,577,718 T411A probably benign Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc10a5 C A 3: 10,335,067 G178W probably damaging Het
Spam1 A T 6: 24,796,725 N225I probably damaging Het
St7 A T 6: 17,844,909 E132V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trbv13-1 A G 6: 41,116,376 K81R possibly damaging Het
Trp53bp2 T C 1: 182,431,598 L72P probably damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r71 T C 7: 10,748,714 T16A possibly damaging Het
Other mutations in Olfr1029
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Olfr1029 APN 2 85975235 utr 5 prime probably benign
IGL02126:Olfr1029 APN 2 85976173 missense probably benign 0.00
IGL02584:Olfr1029 APN 2 85975875 missense probably damaging 0.96
IGL03410:Olfr1029 APN 2 85975420 missense probably damaging 0.99
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1499:Olfr1029 UTSW 2 85976028 missense possibly damaging 0.62
R1584:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R2925:Olfr1029 UTSW 2 85975781 nonsense probably null
R4571:Olfr1029 UTSW 2 85975831 missense probably damaging 0.97
R5533:Olfr1029 UTSW 2 85975453 missense possibly damaging 0.78
R5654:Olfr1029 UTSW 2 85976156 missense probably benign 0.00
R5827:Olfr1029 UTSW 2 85975306 missense probably benign 0.00
R5967:Olfr1029 UTSW 2 85976191 missense probably benign 0.01
R6291:Olfr1029 UTSW 2 85975582 missense probably damaging 1.00
R6735:Olfr1029 UTSW 2 85975434 missense possibly damaging 0.81
R6897:Olfr1029 UTSW 2 85975356 missense possibly damaging 0.45
R7053:Olfr1029 UTSW 2 85976014 missense possibly damaging 0.64
R7163:Olfr1029 UTSW 2 85975588 missense probably damaging 1.00
R7358:Olfr1029 UTSW 2 85975436 missense possibly damaging 0.81
R8047:Olfr1029 UTSW 2 85975927 missense possibly damaging 0.52
R8271:Olfr1029 UTSW 2 85975422 missense probably damaging 1.00
R8271:Olfr1029 UTSW 2 85975741 missense probably benign 0.40
R8364:Olfr1029 UTSW 2 85976014 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGCCATCTTAAGGATCAAATCAGC -3'
(R):5'- GGCCAGATGATTTATTTCAACACAG -3'

Sequencing Primer
(F):5'- TCTTAAGGATCAAATCAGCTGAAGG -3'
(R):5'- TAGGATATGGCCATAGGGA -3'
Posted On2014-12-29