Incidental Mutation 'R2970:Tmem59l'
ID255216
Institutional Source Beutler Lab
Gene Symbol Tmem59l
Ensembl Gene ENSMUSG00000035964
Gene Nametransmembrane protein 59-like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2970 (G1)
Quality Score87
Status Not validated
Chromosome8
Chromosomal Location70483867-70487358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70487301 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 6 (L6S)
Ref Sequence ENSEMBL: ENSMUSP00000043659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045286]
Predicted Effect unknown
Transcript: ENSMUST00000045286
AA Change: L6S
SMART Domains Protein: ENSMUSP00000043659
Gene: ENSMUSG00000035964
AA Change: L6S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 44 60 N/A INTRINSIC
Pfam:BSMAP 72 278 1e-67 PFAM
low complexity region 311 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211264
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted type-I membrane glycoprotein. The encoded protein may play a role in functioning of the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 A G 1: 38,535,022 S253P probably damaging Het
Arhgap12 A T 18: 6,111,732 S211T probably damaging Het
Ccdc186 T G 19: 56,806,998 N416H probably damaging Het
Dusp27 C T 1: 166,099,229 S938N probably benign Het
Eipr1 A T 12: 28,847,594 I152F probably benign Het
Enpp7 T C 11: 118,990,646 S206P probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nipbl C A 15: 8,311,239 C1999F probably damaging Het
Olfr1029 T C 2: 85,976,110 I289T possibly damaging Het
Olfr65 T C 7: 103,907,312 V291A probably benign Het
Olfr961 T C 9: 39,646,899 Y58H probably damaging Het
Pcnx2 A C 8: 125,801,536 L1315R probably damaging Het
Ric1 A G 19: 29,577,718 T411A probably benign Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc10a5 C A 3: 10,335,067 G178W probably damaging Het
Spam1 A T 6: 24,796,725 N225I probably damaging Het
St7 A T 6: 17,844,909 E132V probably damaging Het
Trbv13-1 A G 6: 41,116,376 K81R possibly damaging Het
Trp53bp2 T C 1: 182,431,598 L72P probably damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r71 T C 7: 10,748,714 T16A possibly damaging Het
Other mutations in Tmem59l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Tmem59l APN 8 70485665 splice site probably benign
IGL01479:Tmem59l APN 8 70486098 missense probably benign 0.00
IGL01783:Tmem59l APN 8 70487224 missense probably damaging 1.00
IGL01998:Tmem59l APN 8 70484781 missense probably benign 0.16
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0974:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R1201:Tmem59l UTSW 8 70484387 nonsense probably null
R1540:Tmem59l UTSW 8 70485154 missense probably benign 0.05
R1775:Tmem59l UTSW 8 70486253 missense probably damaging 1.00
R2217:Tmem59l UTSW 8 70487301 missense unknown
R2238:Tmem59l UTSW 8 70485122 missense probably damaging 0.99
R2313:Tmem59l UTSW 8 70487301 missense unknown
R2315:Tmem59l UTSW 8 70487301 missense unknown
R2969:Tmem59l UTSW 8 70487301 missense unknown
R3011:Tmem59l UTSW 8 70486237 missense probably damaging 1.00
R3725:Tmem59l UTSW 8 70487301 missense unknown
R3726:Tmem59l UTSW 8 70487301 missense unknown
R3774:Tmem59l UTSW 8 70487301 missense unknown
R3775:Tmem59l UTSW 8 70487301 missense unknown
R3826:Tmem59l UTSW 8 70487301 missense unknown
R3827:Tmem59l UTSW 8 70487301 missense unknown
R3828:Tmem59l UTSW 8 70487301 missense unknown
R3829:Tmem59l UTSW 8 70487301 missense unknown
R3851:Tmem59l UTSW 8 70487301 missense unknown
R3943:Tmem59l UTSW 8 70487301 missense unknown
R3944:Tmem59l UTSW 8 70487301 missense unknown
R4064:Tmem59l UTSW 8 70485719 missense probably damaging 1.00
R4409:Tmem59l UTSW 8 70487301 missense unknown
R4410:Tmem59l UTSW 8 70487301 missense unknown
R4422:Tmem59l UTSW 8 70486099 missense probably damaging 0.98
R4470:Tmem59l UTSW 8 70487301 missense unknown
R4471:Tmem59l UTSW 8 70487301 missense unknown
R4767:Tmem59l UTSW 8 70486098 missense probably benign 0.00
R5321:Tmem59l UTSW 8 70487215 missense probably damaging 1.00
R6130:Tmem59l UTSW 8 70484605 missense probably damaging 1.00
R6527:Tmem59l UTSW 8 70486125 missense probably damaging 1.00
R6603:Tmem59l UTSW 8 70486356 missense probably benign 0.31
R6750:Tmem59l UTSW 8 70486372 missense probably benign 0.34
R7542:Tmem59l UTSW 8 70485164 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCCATCTGAGGGTCCTACAC -3'
(R):5'- GATCCAAGTCCGGTCAAAGAG -3'

Sequencing Primer
(F):5'- AGGGTCCTACACTCAGGTC -3'
(R):5'- TCAGTGACGTCAACACC -3'
Posted On2014-12-29