Incidental Mutation 'R2970:Olfr961'
ID255218
Institutional Source Beutler Lab
Gene Symbol Olfr961
Ensembl Gene ENSMUSG00000059106
Gene Nameolfactory receptor 961
SynonymsMOR224-5, GA_x6K02T2PVTD-33343617-33344561
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R2970 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39645085-39649556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39646899 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 58 (Y58H)
Ref Sequence ENSEMBL: ENSMUSP00000151840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076548] [ENSMUST00000219295]
Predicted Effect probably damaging
Transcript: ENSMUST00000076548
AA Change: Y58H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075863
Gene: ENSMUSG00000059106
AA Change: Y58H

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.1e-50 PFAM
Pfam:7tm_1 39 286 4.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219295
AA Change: Y58H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 A G 1: 38,535,022 S253P probably damaging Het
Arhgap12 A T 18: 6,111,732 S211T probably damaging Het
Ccdc186 T G 19: 56,806,998 N416H probably damaging Het
Dusp27 C T 1: 166,099,229 S938N probably benign Het
Eipr1 A T 12: 28,847,594 I152F probably benign Het
Enpp7 T C 11: 118,990,646 S206P probably damaging Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Mrgprb5 T A 7: 48,168,569 R139S probably damaging Het
Nipbl C A 15: 8,311,239 C1999F probably damaging Het
Olfr1029 T C 2: 85,976,110 I289T possibly damaging Het
Olfr65 T C 7: 103,907,312 V291A probably benign Het
Pcnx2 A C 8: 125,801,536 L1315R probably damaging Het
Ric1 A G 19: 29,577,718 T411A probably benign Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Slc10a5 C A 3: 10,335,067 G178W probably damaging Het
Spam1 A T 6: 24,796,725 N225I probably damaging Het
St7 A T 6: 17,844,909 E132V probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trbv13-1 A G 6: 41,116,376 K81R possibly damaging Het
Trp53bp2 T C 1: 182,431,598 L72P probably damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn1r71 T C 7: 10,748,714 T16A possibly damaging Het
Other mutations in Olfr961
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr961 APN 9 39647340 missense probably benign 0.19
IGL01792:Olfr961 APN 9 39647659 missense probably benign 0.07
R0344:Olfr961 UTSW 9 39647350 missense probably damaging 1.00
R0503:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R0525:Olfr961 UTSW 9 39647471 missense probably damaging 1.00
R0531:Olfr961 UTSW 9 39646872 missense probably benign
R1188:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R1453:Olfr961 UTSW 9 39647163 missense probably benign 0.01
R3883:Olfr961 UTSW 9 39647124 missense probably benign 0.07
R4423:Olfr961 UTSW 9 39647116 missense probably damaging 1.00
R5129:Olfr961 UTSW 9 39647494 missense probably benign 0.03
R6148:Olfr961 UTSW 9 39647259 missense probably damaging 1.00
R6738:Olfr961 UTSW 9 39646661 start gained probably benign
R6778:Olfr961 UTSW 9 39646747 missense probably damaging 1.00
R7194:Olfr961 UTSW 9 39647091 missense probably benign 0.15
R7545:Olfr961 UTSW 9 39647107 missense probably damaging 0.97
RF008:Olfr961 UTSW 9 39647263 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTTTCCACAGACTCCCAGGAG -3'
(R):5'- AAAGCGGTCATAGGCCATC -3'

Sequencing Primer
(F):5'- GACTCCCAGGAGCTGATTCATC -3'
(R):5'- GTCATAGGCCATCACTGTGTACAAG -3'
Posted On2014-12-29