Incidental Mutation 'R2972:Nsun6'
ID255231
Institutional Source Beutler Lab
Gene Symbol Nsun6
Ensembl Gene ENSMUSG00000026707
Gene NameNOL1/NOP2/Sun domain family member 6
Synonyms4933414E04Rik, 4933403D21Rik, NOPD1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2972 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location14995131-15055069 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 15038072 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028034] [ENSMUST00000076435] [ENSMUST00000114713] [ENSMUST00000114715] [ENSMUST00000195749]
Predicted Effect probably null
Transcript: ENSMUST00000028034
SMART Domains Protein: ENSMUSP00000028034
Gene: ENSMUSG00000026707

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076435
SMART Domains Protein: ENSMUSP00000075766
Gene: ENSMUSG00000026707

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 224 392 4.7e-9 PFAM
Pfam:Nol1_Nop2_Fmu 227 464 4.7e-48 PFAM
Pfam:Methyltransf_31 232 423 8.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114713
Predicted Effect probably null
Transcript: ENSMUST00000114715
SMART Domains Protein: ENSMUSP00000110363
Gene: ENSMUSG00000026707

DomainStartEndE-ValueType
PUA 61 152 1.96e-4 SMART
Pfam:FtsJ 165 346 4.5e-9 PFAM
Pfam:Methyltransf_31 181 372 2.3e-10 PFAM
Pfam:Methyltransf_18 183 322 2.8e-9 PFAM
Pfam:Methyltransf_26 184 323 5.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195431
Predicted Effect probably null
Transcript: ENSMUST00000195749
SMART Domains Protein: ENSMUSP00000141924
Gene: ENSMUSG00000026707

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC048507 T C 13: 67,863,630 I42T probably benign Het
Card9 C T 2: 26,357,210 R309H probably damaging Het
Clec14a T A 12: 58,267,574 R421W probably damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Dhrs7c T A 11: 67,815,871 I285N possibly damaging Het
Golga2 A G 2: 32,305,659 N752S probably benign Het
Klrb1-ps1 A G 6: 129,119,756 noncoding transcript Het
Nin G A 12: 70,062,713 R151C probably damaging Het
Nyap2 C T 1: 81,191,770 R81* probably null Het
Olfr1241 G T 2: 89,482,776 R120S possibly damaging Het
Olfr354 G A 2: 36,907,404 V153M probably benign Het
Pkhd1l1 T A 15: 44,547,248 M2717K possibly damaging Het
Ralgapa1 T C 12: 55,820,755 K5E possibly damaging Het
Rnf130 T A 11: 50,093,800 L309* probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rxrg G A 1: 167,639,146 R422H probably damaging Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Slc10a5 A T 3: 10,334,457 I381N probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Ubr4 T C 4: 139,406,536 Y748H probably benign Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Vmn2r77 T C 7: 86,803,685 Y537H probably benign Het
Other mutations in Nsun6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Nsun6 APN 2 15048978 missense possibly damaging 0.69
IGL02347:Nsun6 APN 2 15030020 splice site probably benign
IGL03352:Nsun6 APN 2 14996346 nonsense probably null
R0371:Nsun6 UTSW 2 15030087 missense probably damaging 1.00
R0639:Nsun6 UTSW 2 14996336 missense probably benign
R0737:Nsun6 UTSW 2 14996474 missense probably damaging 1.00
R1076:Nsun6 UTSW 2 15009472 missense probably benign 0.01
R1676:Nsun6 UTSW 2 15047213 nonsense probably null
R1842:Nsun6 UTSW 2 15009477 missense probably damaging 0.98
R1989:Nsun6 UTSW 2 15038184 missense probably benign
R2091:Nsun6 UTSW 2 15039731 critical splice donor site probably null
R3276:Nsun6 UTSW 2 15009404 splice site probably benign
R4386:Nsun6 UTSW 2 14996522 missense probably benign 0.05
R4761:Nsun6 UTSW 2 15030061 missense possibly damaging 0.88
R4782:Nsun6 UTSW 2 15036326 missense possibly damaging 0.88
R6701:Nsun6 UTSW 2 15036302 missense probably benign 0.00
R6890:Nsun6 UTSW 2 15048977 missense probably damaging 1.00
R7555:Nsun6 UTSW 2 14996339 missense possibly damaging 0.73
R7587:Nsun6 UTSW 2 15039825 missense probably benign
R7880:Nsun6 UTSW 2 14996379 missense probably damaging 0.99
R7888:Nsun6 UTSW 2 14996544 missense probably benign 0.01
R7963:Nsun6 UTSW 2 14996379 missense probably damaging 0.99
R7971:Nsun6 UTSW 2 14996544 missense probably benign 0.01
Z1177:Nsun6 UTSW 2 15030103 missense probably damaging 1.00
Z1177:Nsun6 UTSW 2 15039820 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCACTCACCACTAGCTTC -3'
(R):5'- ACAGATAACCGTTTTAGCTTGAAGG -3'

Sequencing Primer
(F):5'- ATCCACATCCTACTGCTTTGG -3'
(R):5'- GCTAAAGCACAGGTTAACAGTTTG -3'
Posted On2014-12-29