Incidental Mutation 'R2972:Klrb1-ps1'
ID255242
Institutional Source Beutler Lab
Gene Symbol Klrb1-ps1
Ensembl Gene ENSMUSG00000079295
Gene Namekiller cell lectin-like receptor subfamily B member 1, pseudogene 1
SynonymsNkrp1e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2972 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location129116518-129129446 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 129119756 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000071342
Gene: ENSMUSG00000079295

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
CLECT 94 170 1.28e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000071342
Gene: ENSMUSG00000079295

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
CLECT 94 170 1.28e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203057
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC048507 T C 13: 67,863,630 I42T probably benign Het
Card9 C T 2: 26,357,210 R309H probably damaging Het
Clec14a T A 12: 58,267,574 R421W probably damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Dhrs7c T A 11: 67,815,871 I285N possibly damaging Het
Golga2 A G 2: 32,305,659 N752S probably benign Het
Nin G A 12: 70,062,713 R151C probably damaging Het
Nsun6 A C 2: 15,038,072 probably null Het
Nyap2 C T 1: 81,191,770 R81* probably null Het
Olfr1241 G T 2: 89,482,776 R120S possibly damaging Het
Olfr354 G A 2: 36,907,404 V153M probably benign Het
Pkhd1l1 T A 15: 44,547,248 M2717K possibly damaging Het
Ralgapa1 T C 12: 55,820,755 K5E possibly damaging Het
Rnf130 T A 11: 50,093,800 L309* probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rxrg G A 1: 167,639,146 R422H probably damaging Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Slc10a5 A T 3: 10,334,457 I381N probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Ubr4 T C 4: 139,406,536 Y748H probably benign Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Vmn2r77 T C 7: 86,803,685 Y537H probably benign Het
Other mutations in Klrb1-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Klrb1-ps1 APN 6 129116585 missense possibly damaging 0.91
IGL02067:Klrb1-ps1 APN 6 129129388 missense probably damaging 1.00
IGL02218:Klrb1-ps1 APN 6 129129306 splice site noncoding transcript
IGL02316:Klrb1-ps1 APN 6 129116569 exon noncoding transcript
R0035:Klrb1-ps1 UTSW 6 129129343 missense possibly damaging 0.80
R2993:Klrb1-ps1 UTSW 6 129121029 missense probably benign 0.19
R5076:Klrb1-ps1 UTSW 6 129119788 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AGCTGAACCTAATGGAGAGTTC -3'
(R):5'- TGGACATGGGATACTGTCCTG -3'

Sequencing Primer
(F):5'- CTGAACCTAATGGAGAGTTCATTTCG -3'
(R):5'- CATGTGAAGAGGCACCGATATTTATG -3'
Posted On2014-12-29