Mutagenetix > Incidental Mutation

Incidental Mutation 'R2972:Vmn2r77'

255244

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r77

Ensembl Gene

ENSMUSG00000090949

Gene Name

vomeronasal 2, receptor 77

Synonyms

EG546983

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R2972 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86795141-86812032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86803685 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 537 (Y537H)

Ref Sequence

ENSEMBL: ENSMUSP00000129540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164996]

AlphaFold

L7N2B7

Predicted Effect

probably benign
Transcript: ENSMUST00000164996
AA Change: Y537H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: Y537H

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	78	467	1.4e-30	PFAM
Pfam:NCD3G	510	562	1e-20	PFAM
Pfam:7tm_3	594	830	2.6e-52	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
BC048507	T	C	13: 67,863,630	I42T	probably benign	Het
Card9	C	T	2: 26,357,210	R309H	probably damaging	Het
Clec14a	T	A	12: 58,267,574	R421W	probably damaging	Het
Crnkl1	A	G	2: 145,932,261	L94P	probably benign	Het
D930007J09Rik	C	T	13: 32,802,759		probably benign	Het
Dhrs7c	T	A	11: 67,815,871	I285N	possibly damaging	Het
Golga2	A	G	2: 32,305,659	N752S	probably benign	Het
Klrb1-ps1	A	G	6: 129,119,756		noncoding transcript	Het
Nin	G	A	12: 70,062,713	R151C	probably damaging	Het
Nsun6	A	C	2: 15,038,072		probably null	Het
Nyap2	C	T	1: 81,191,770	R81*	probably null	Het
Olfr1241	G	T	2: 89,482,776	R120S	possibly damaging	Het
Olfr354	G	A	2: 36,907,404	V153M	probably benign	Het
Pkhd1l1	T	A	15: 44,547,248	M2717K	possibly damaging	Het
Ralgapa1	T	C	12: 55,820,755	K5E	possibly damaging	Het
Rnf130	T	A	11: 50,093,800	L309*	probably null	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Rxrg	G	A	1: 167,639,146	R422H	probably damaging	Het
Serpinb9e	T	A	13: 33,255,143	V184E	probably benign	Het
Slc10a5	A	T	3: 10,334,457	I381N	probably damaging	Het
Slit1	G	A	19: 41,611,016	P1032L	probably benign	Het
Sptlc3	A	G	2: 139,589,661	T368A	probably damaging	Het
Ubr4	T	C	4: 139,406,536	Y748H	probably benign	Het
Ugt8a	T	C	3: 125,915,308	H51R	probably benign	Het
Vmn2r117	A	G	17: 23,459,856	V798A	probably damaging	Het

Other mutations in Vmn2r77

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Vmn2r77	APN	7	86800767	missense	probably benign	0.06
IGL01105:Vmn2r77	APN	7	86811664	missense	probably damaging	0.99
IGL01367:Vmn2r77	APN	7	86811916	missense	probably damaging	0.98
IGL01634:Vmn2r77	APN	7	86811649	missense	probably benign
IGL01805:Vmn2r77	APN	7	86811187	missense	probably benign	0.18
IGL01868:Vmn2r77	APN	7	86803016	missense	probably benign	0.00
IGL01980:Vmn2r77	APN	7	86801470	missense	probably benign	0.14
IGL02055:Vmn2r77	APN	7	86801555	missense	probably benign	0.00
IGL02066:Vmn2r77	APN	7	86803628	nonsense	probably null
IGL02185:Vmn2r77	APN	7	86795152	missense	unknown
IGL02200:Vmn2r77	APN	7	86801979	missense	probably benign	0.04
IGL02336:Vmn2r77	APN	7	86802016	missense	probably damaging	0.99
IGL02445:Vmn2r77	APN	7	86803640	nonsense	probably null
IGL02557:Vmn2r77	APN	7	86795134	unclassified	probably benign
IGL02659:Vmn2r77	APN	7	86800771	missense	probably benign	0.32
IGL02978:Vmn2r77	APN	7	86811347	missense	probably benign
IGL03180:Vmn2r77	APN	7	86801635	missense	possibly damaging	0.85
IGL03255:Vmn2r77	APN	7	86811923	missense	probably benign	0.04
IGL03273:Vmn2r77	APN	7	86811286	missense	probably damaging	0.99
R0046:Vmn2r77	UTSW	7	86801938	missense	possibly damaging	0.73
R0047:Vmn2r77	UTSW	7	86811650	missense	probably benign	0.01
R0066:Vmn2r77	UTSW	7	86800756	missense	probably benign	0.17
R0066:Vmn2r77	UTSW	7	86800756	missense	probably benign	0.17
R0389:Vmn2r77	UTSW	7	86801494	missense	probably benign	0.29
R0635:Vmn2r77	UTSW	7	86811175	missense	probably benign
R0689:Vmn2r77	UTSW	7	86811664	missense	probably damaging	0.99
R0827:Vmn2r77	UTSW	7	86802016	missense	probably damaging	1.00
R1167:Vmn2r77	UTSW	7	86801746	missense	probably benign	0.02
R1228:Vmn2r77	UTSW	7	86801034	critical splice donor site	probably null
R1353:Vmn2r77	UTSW	7	86802186	missense	probably benign	0.29
R1392:Vmn2r77	UTSW	7	86801622	missense	probably benign	0.00
R1392:Vmn2r77	UTSW	7	86801622	missense	probably benign	0.00
R1613:Vmn2r77	UTSW	7	86811148	missense	probably damaging	1.00
R1654:Vmn2r77	UTSW	7	86811915	missense	probably damaging	1.00
R1742:Vmn2r77	UTSW	7	86795335	missense	probably benign	0.35
R1827:Vmn2r77	UTSW	7	86801613	missense	probably damaging	0.99
R1911:Vmn2r77	UTSW	7	86811793	missense	probably damaging	1.00
R1974:Vmn2r77	UTSW	7	86800756	missense	probably benign	0.17
R2008:Vmn2r77	UTSW	7	86801713	missense	probably benign	0.31
R2093:Vmn2r77	UTSW	7	86801494	missense	probably benign	0.29
R2143:Vmn2r77	UTSW	7	86811944	missense	probably damaging	1.00
R2269:Vmn2r77	UTSW	7	86811689	missense	probably benign	0.03
R2974:Vmn2r77	UTSW	7	86803685	missense	probably benign	0.01
R3037:Vmn2r77	UTSW	7	86800983	missense	probably benign
R3694:Vmn2r77	UTSW	7	86800836	missense	probably damaging	1.00
R3695:Vmn2r77	UTSW	7	86800836	missense	probably damaging	1.00
R3805:Vmn2r77	UTSW	7	86795160	nonsense	probably null
R3870:Vmn2r77	UTSW	7	86811842	missense	probably damaging	1.00
R4732:Vmn2r77	UTSW	7	86800987	missense	probably benign	0.00
R4733:Vmn2r77	UTSW	7	86800987	missense	probably benign	0.00
R5009:Vmn2r77	UTSW	7	86801807	missense	possibly damaging	0.82
R5201:Vmn2r77	UTSW	7	86811638	missense	probably damaging	0.98
R5218:Vmn2r77	UTSW	7	86802133	missense	probably damaging	0.98
R5469:Vmn2r77	UTSW	7	86802063	missense	probably benign	0.01
R5673:Vmn2r77	UTSW	7	86812006	missense	probably benign	0.05
R5771:Vmn2r77	UTSW	7	86812027	missense	probably benign	0.06
R5832:Vmn2r77	UTSW	7	86811462	nonsense	probably null
R5899:Vmn2r77	UTSW	7	86811716	missense	probably damaging	1.00
R6151:Vmn2r77	UTSW	7	86801670	missense	probably benign	0.00
R6182:Vmn2r77	UTSW	7	86811749	missense	probably damaging	1.00
R6326:Vmn2r77	UTSW	7	86801823	missense	probably benign
R6419:Vmn2r77	UTSW	7	86811559	missense	probably damaging	0.99
R6549:Vmn2r77	UTSW	7	86800857	missense	probably benign	0.06
R6874:Vmn2r77	UTSW	7	86802078	missense	probably benign	0.00
R6972:Vmn2r77	UTSW	7	86802994	missense	probably damaging	1.00
R7056:Vmn2r77	UTSW	7	86801815	missense	probably benign	0.06
R7185:Vmn2r77	UTSW	7	86801827	missense	probably benign	0.00
R7261:Vmn2r77	UTSW	7	86811310	nonsense	probably null
R7298:Vmn2r77	UTSW	7	86800771	missense	probably benign	0.00
R7662:Vmn2r77	UTSW	7	86811284	nonsense	probably null
R8182:Vmn2r77	UTSW	7	86811593	missense	probably damaging	1.00
R8327:Vmn2r77	UTSW	7	86801472	missense	probably benign	0.08
R8387:Vmn2r77	UTSW	7	86801739	missense	probably benign	0.00
R8825:Vmn2r77	UTSW	7	86803647	missense	probably benign
R8898:Vmn2r77	UTSW	7	86795222	missense	probably damaging	1.00
R8973:Vmn2r77	UTSW	7	86802942	missense	possibly damaging	0.93
R9258:Vmn2r77	UTSW	7	86803094	missense	possibly damaging	0.88
R9338:Vmn2r77	UTSW	7	86811786	missense	probably damaging	1.00
R9358:Vmn2r77	UTSW	7	86803028	missense	probably benign	0.00
R9377:Vmn2r77	UTSW	7	86795234	missense	probably benign	0.05
R9404:Vmn2r77	UTSW	7	86802039	missense	probably benign
R9673:Vmn2r77	UTSW	7	86800963	missense	possibly damaging	0.75
R9679:Vmn2r77	UTSW	7	86811533	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AAAGGGAAGTCTTTCAGTGGC -3'
(R):5'- CCATTTGGGCAGAGAAGAAATTATG -3'

Sequencing Primer
(F):5'- AAGGGAAGTCTTTCAGTGGCATTTTC -3'
(R):5'- GGCAACAATACCATTTATGACACAC -3'

Posted On

2014-12-29