Mutagenetix > Incidental Mutation

Incidental Mutation 'R2972:Vmn2r117'

255257

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R2972 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23459856 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 798 (V798A)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000171996
AA Change: V798A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: V798A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
BC048507	T	C	13: 67,863,630	I42T	probably benign	Het
Card9	C	T	2: 26,357,210	R309H	probably damaging	Het
Clec14a	T	A	12: 58,267,574	R421W	probably damaging	Het
Crnkl1	A	G	2: 145,932,261	L94P	probably benign	Het
D930007J09Rik	C	T	13: 32,802,759		probably benign	Het
Dhrs7c	T	A	11: 67,815,871	I285N	possibly damaging	Het
Golga2	A	G	2: 32,305,659	N752S	probably benign	Het
Klrb1-ps1	A	G	6: 129,119,756		noncoding transcript	Het
Nin	G	A	12: 70,062,713	R151C	probably damaging	Het
Nsun6	A	C	2: 15,038,072		probably null	Het
Nyap2	C	T	1: 81,191,770	R81*	probably null	Het
Olfr1241	G	T	2: 89,482,776	R120S	possibly damaging	Het
Olfr354	G	A	2: 36,907,404	V153M	probably benign	Het
Pkhd1l1	T	A	15: 44,547,248	M2717K	possibly damaging	Het
Ralgapa1	T	C	12: 55,820,755	K5E	possibly damaging	Het
Rnf130	T	A	11: 50,093,800	L309*	probably null	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Rxrg	G	A	1: 167,639,146	R422H	probably damaging	Het
Serpinb9e	T	A	13: 33,255,143	V184E	probably benign	Het
Slc10a5	A	T	3: 10,334,457	I381N	probably damaging	Het
Slit1	G	A	19: 41,611,016	P1032L	probably benign	Het
Sptlc3	A	G	2: 139,589,661	T368A	probably damaging	Het
Ubr4	T	C	4: 139,406,536	Y748H	probably benign	Het
Ugt8a	T	C	3: 125,915,308	H51R	probably benign	Het
Vmn2r77	T	C	7: 86,803,685	Y537H	probably benign	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2082:Vmn2r117	UTSW	17	23460256	missense	possibly damaging	0.55
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4560:Vmn2r117	UTSW	17	23459877	missense	probably damaging	1.00
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4881:Vmn2r117	UTSW	17	23477885	missense	probably damaging	1.00
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R5774:Vmn2r117	UTSW	17	23477202	missense	probably damaging	0.98
R6014:Vmn2r117	UTSW	17	23479561	missense	probably damaging	0.97
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6674:Vmn2r117	UTSW	17	23460049	nonsense	probably null
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R6913:Vmn2r117	UTSW	17	23479563	missense	probably damaging	0.99
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7644:Vmn2r117	UTSW	17	23477291	missense	probably damaging	0.98
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8519:Vmn2r117	UTSW	17	23479468	missense	probably benign
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAGCATTGGAAGATGATTTCACCC -3'
(R):5'- AGTCTGGCTGAGAGCTTCTC -3'

Sequencing Primer
(F):5'- TGGAAGATGATTTCACCCTGATC -3'
(R):5'- TGCACATTCTGAGCATGGAC -3'

Posted On

2014-12-29