Incidental Mutation 'R2972:Vmn2r117'
ID 255257
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Name vomeronasal 2, receptor 117
Synonyms EG619788, V2Rp6
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R2972 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 23678649-23698571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23678830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 798 (V798A)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
AlphaFold K7N6V1
Predicted Effect probably damaging
Transcript: ENSMUST00000171996
AA Change: V798A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: V798A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC048507 T C 13: 68,011,749 (GRCm39) I42T probably benign Het
Card9 C T 2: 26,247,222 (GRCm39) R309H probably damaging Het
Clec14a T A 12: 58,314,360 (GRCm39) R421W probably damaging Het
Crnkl1 A G 2: 145,774,181 (GRCm39) L94P probably benign Het
D930007J09Rik C T 13: 32,986,742 (GRCm39) probably benign Het
Dhrs7c T A 11: 67,706,697 (GRCm39) I285N possibly damaging Het
Golga2 A G 2: 32,195,671 (GRCm39) N752S probably benign Het
Klrb1-ps1 A G 6: 129,096,719 (GRCm39) noncoding transcript Het
Nin G A 12: 70,109,487 (GRCm39) R151C probably damaging Het
Nsun6 A C 2: 15,042,883 (GRCm39) probably null Het
Nyap2 C T 1: 81,169,485 (GRCm39) R81* probably null Het
Or1n2 G A 2: 36,797,416 (GRCm39) V153M probably benign Het
Or4a69 G T 2: 89,313,120 (GRCm39) R120S possibly damaging Het
Pkhd1l1 T A 15: 44,410,644 (GRCm39) M2717K possibly damaging Het
Ralgapa1 T C 12: 55,867,540 (GRCm39) K5E possibly damaging Het
Rnf130 T A 11: 49,984,627 (GRCm39) L309* probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rxrg G A 1: 167,466,715 (GRCm39) R422H probably damaging Het
Serpinb9e T A 13: 33,439,126 (GRCm39) V184E probably benign Het
Slc10a5 A T 3: 10,399,517 (GRCm39) I381N probably damaging Het
Slit1 G A 19: 41,599,455 (GRCm39) P1032L probably benign Het
Sptlc3 A G 2: 139,431,581 (GRCm39) T368A probably damaging Het
Ubr4 T C 4: 139,133,847 (GRCm39) Y748H probably benign Het
Ugt8a T C 3: 125,708,957 (GRCm39) H51R probably benign Het
Vmn2r77 T C 7: 86,452,893 (GRCm39) Y537H probably benign Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23,698,520 (GRCm39) missense probably benign
IGL00990:Vmn2r117 APN 17 23,696,814 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23,694,403 (GRCm39) missense probably damaging 1.00
IGL01078:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23,697,356 (GRCm39) missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23,696,215 (GRCm39) missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23,694,356 (GRCm39) missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23,696,199 (GRCm39) missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23,678,758 (GRCm39) missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23,694,552 (GRCm39) splice site probably benign
IGL03167:Vmn2r117 APN 17 23,696,681 (GRCm39) missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23,679,139 (GRCm39) missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23,694,488 (GRCm39) missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23,694,477 (GRCm39) nonsense probably null
R1411:Vmn2r117 UTSW 17 23,679,527 (GRCm39) missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23,697,447 (GRCm39) missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23,696,429 (GRCm39) missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23,697,363 (GRCm39) missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23,696,454 (GRCm39) missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23,696,618 (GRCm39) missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23,679,230 (GRCm39) missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23,678,885 (GRCm39) missense probably damaging 0.98
R2973:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3847:Vmn2r117 UTSW 17 23,679,389 (GRCm39) missense probably damaging 0.97
R3848:Vmn2r117 UTSW 17 23,679,389 (GRCm39) missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23,679,080 (GRCm39) missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R4560:Vmn2r117 UTSW 17 23,678,851 (GRCm39) missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23,697,390 (GRCm39) missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23,696,859 (GRCm39) missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23,678,812 (GRCm39) missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R5078:Vmn2r117 UTSW 17 23,679,122 (GRCm39) missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23,696,848 (GRCm39) nonsense probably null
R5774:Vmn2r117 UTSW 17 23,696,176 (GRCm39) missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23,698,535 (GRCm39) missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23,679,088 (GRCm39) missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23,679,193 (GRCm39) missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23,679,023 (GRCm39) nonsense probably null
R6736:Vmn2r117 UTSW 17 23,697,282 (GRCm39) missense probably damaging 0.99
R6909:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23,698,537 (GRCm39) missense probably damaging 0.99
R7220:Vmn2r117 UTSW 17 23,696,177 (GRCm39) missense probably damaging 1.00
R7260:Vmn2r117 UTSW 17 23,694,359 (GRCm39) missense probably benign 0.06
R7440:Vmn2r117 UTSW 17 23,694,539 (GRCm39) missense probably benign 0.26
R7443:Vmn2r117 UTSW 17 23,679,319 (GRCm39) missense probably damaging 1.00
R7443:Vmn2r117 UTSW 17 23,679,107 (GRCm39) missense probably benign 0.25
R7449:Vmn2r117 UTSW 17 23,678,869 (GRCm39) missense probably damaging 1.00
R7644:Vmn2r117 UTSW 17 23,696,265 (GRCm39) missense probably damaging 0.98
R7914:Vmn2r117 UTSW 17 23,679,100 (GRCm39) missense possibly damaging 0.95
R8001:Vmn2r117 UTSW 17 23,698,381 (GRCm39) missense possibly damaging 0.89
R8029:Vmn2r117 UTSW 17 23,696,744 (GRCm39) missense probably benign 0.00
R8340:Vmn2r117 UTSW 17 23,679,511 (GRCm39) missense probably benign 0.01
R8519:Vmn2r117 UTSW 17 23,698,442 (GRCm39) missense probably benign
R8723:Vmn2r117 UTSW 17 23,696,343 (GRCm39) missense probably damaging 1.00
R8914:Vmn2r117 UTSW 17 23,679,143 (GRCm39) missense probably benign 0.02
R9010:Vmn2r117 UTSW 17 23,679,445 (GRCm39) missense probably benign 0.10
R9129:Vmn2r117 UTSW 17 23,678,918 (GRCm39) nonsense probably null
R9244:Vmn2r117 UTSW 17 23,696,589 (GRCm39) missense probably damaging 0.98
R9464:Vmn2r117 UTSW 17 23,696,578 (GRCm39) missense probably benign 0.23
R9620:Vmn2r117 UTSW 17 23,697,450 (GRCm39) missense probably damaging 0.97
V5622:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
V5622:Vmn2r117 UTSW 17 23,696,814 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r117 UTSW 17 23,678,740 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCATTGGAAGATGATTTCACCC -3'
(R):5'- AGTCTGGCTGAGAGCTTCTC -3'

Sequencing Primer
(F):5'- TGGAAGATGATTTCACCCTGATC -3'
(R):5'- TGCACATTCTGAGCATGGAC -3'
Posted On 2014-12-29