Incidental Mutation 'R2973:Sptlc3'
ID255262
Institutional Source Beutler Lab
Gene Symbol Sptlc3
Ensembl Gene ENSMUSG00000039092
Gene Nameserine palmitoyltransferase, long chain base subunit 3
Synonyms
MMRRC Submission 040526-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R2973 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location139493913-139637674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139589661 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 368 (T368A)
Ref Sequence ENSEMBL: ENSMUSP00000105710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]
Predicted Effect probably damaging
Transcript: ENSMUST00000047370
AA Change: T368A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: T368A

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110083
AA Change: T368A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: T368A

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184747
Meta Mutation Damage Score 0.9207 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,786 D32G probably benign Het
Abca7 T G 10: 80,008,967 F1508V probably damaging Het
Angptl7 T A 4: 148,500,214 K26* probably null Het
BC048507 T C 13: 67,863,630 I42T probably benign Het
Cald1 A G 6: 34,757,996 probably benign Het
Ces5a A G 8: 93,528,504 F187S probably damaging Het
Chd3 A G 11: 69,360,616 Y530H probably damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Cst9 G T 2: 148,835,225 probably null Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Dcaf10 T C 4: 45,373,957 S461P probably benign Het
Dhx36 T A 3: 62,495,495 N279Y probably benign Het
Dhx36 C G 3: 62,495,498 G278R possibly damaging Het
Doxl2 A G 6: 48,976,424 T428A probably benign Het
Eps8l3 T C 3: 107,891,328 I510T probably damaging Het
Gab2 A G 7: 97,223,552 E54G probably benign Het
Gsdme A G 6: 50,229,324 C180R probably damaging Het
Hesx1 A G 14: 27,000,642 probably benign Het
Il5ra G A 6: 106,741,235 P86L probably benign Het
Jakmip1 A G 5: 37,091,527 K177R probably damaging Het
Larp4b T C 13: 9,166,311 probably benign Het
Lrrc42 A T 4: 107,239,114 D40E probably damaging Het
Mefv G A 16: 3,715,694 R238* probably null Het
Mroh9 A T 1: 163,056,769 M400K probably damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr204 A C 16: 59,315,404 M1R probably null Het
Olfr527 T G 7: 140,336,387 F175C probably damaging Het
Plec C G 15: 76,188,761 G631R probably damaging Het
Polr3b A G 10: 84,628,280 K35E probably benign Het
Ppef2 T C 5: 92,239,094 E328G probably benign Het
Rogdi G T 16: 5,011,662 Q90K probably damaging Het
Rtn1 C A 12: 72,223,389 R116L probably damaging Het
Sept14 T C 5: 129,699,022 H31R probably benign Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Slc10a5 A T 3: 10,334,457 I381N probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Tm9sf1 T A 14: 55,641,114 T274S probably benign Het
Tpgs1 A G 10: 79,669,615 E69G probably damaging Het
Trpv5 T C 6: 41,653,231 S642G possibly damaging Het
Ttn A C 2: 76,802,317 I12385S probably damaging Het
Ube2e2 T C 14: 18,630,321 D137G possibly damaging Het
Ubr4 T C 4: 139,406,536 Y748H probably benign Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vcp T A 4: 42,996,315 I16F probably damaging Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Other mutations in Sptlc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Sptlc3 APN 2 139546421 missense possibly damaging 0.55
IGL01537:Sptlc3 APN 2 139589695 missense possibly damaging 0.95
IGL01996:Sptlc3 APN 2 139581504 splice site probably benign
IGL02512:Sptlc3 APN 2 139547203 missense probably damaging 1.00
IGL03278:Sptlc3 APN 2 139589659 missense probably damaging 1.00
IGL03286:Sptlc3 APN 2 139589659 missense probably damaging 1.00
R0266:Sptlc3 UTSW 2 139596037 missense possibly damaging 0.93
R0362:Sptlc3 UTSW 2 139546555 splice site probably benign
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1494:Sptlc3 UTSW 2 139589560 missense possibly damaging 0.58
R1847:Sptlc3 UTSW 2 139625923 missense probably benign 0.08
R1919:Sptlc3 UTSW 2 139566675 missense possibly damaging 0.66
R2093:Sptlc3 UTSW 2 139625874 missense possibly damaging 0.89
R2396:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R2972:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2974:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R4601:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4602:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4610:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4745:Sptlc3 UTSW 2 139547167 missense probably damaging 1.00
R4779:Sptlc3 UTSW 2 139589589 missense probably benign 0.04
R4992:Sptlc3 UTSW 2 139596003 missense probably benign 0.04
R5162:Sptlc3 UTSW 2 139631343 missense probably benign 0.11
R5401:Sptlc3 UTSW 2 139636723 missense possibly damaging 0.75
R5406:Sptlc3 UTSW 2 139546478 missense probably benign 0.26
R5642:Sptlc3 UTSW 2 139546408 missense probably damaging 0.96
R5840:Sptlc3 UTSW 2 139547206 missense probably damaging 1.00
R6057:Sptlc3 UTSW 2 139581613 missense probably damaging 0.99
R6376:Sptlc3 UTSW 2 139636772 missense probably benign 0.21
R6852:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R7026:Sptlc3 UTSW 2 139537688 missense probably benign
R7412:Sptlc3 UTSW 2 139589617 missense possibly damaging 0.75
R7516:Sptlc3 UTSW 2 139589518 missense probably benign 0.11
R7733:Sptlc3 UTSW 2 139631368 missense possibly damaging 0.77
R7826:Sptlc3 UTSW 2 139547195 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGTGCTAGCATGGAAGGTTC -3'
(R):5'- TCTCCCAGGTACTCTACACAG -3'

Sequencing Primer
(F):5'- CCATTGTGAACCTTGCCCAGATAG -3'
(R):5'- CCAGGTACTCTACACAGTTTGTTATG -3'
Posted On2014-12-29