Incidental Mutation 'R2973:Dhx36'
ID255266
Institutional Source Beutler Lab
Gene Symbol Dhx36
Ensembl Gene ENSMUSG00000027770
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 36
Synonyms2810407E23Rik, Ddx36
MMRRC Submission 040526-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2973 (G1)
Quality Score163
Status Validated
Chromosome3
Chromosomal Location62468013-62507004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62495495 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 279 (N279Y)
Ref Sequence ENSEMBL: ENSMUSP00000029336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029336]
Predicted Effect probably benign
Transcript: ENSMUST00000029336
AA Change: N279Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770
AA Change: N279Y

DomainStartEndE-ValueType
low complexity region 10 45 N/A INTRINSIC
DEXDc 198 389 1.53e-31 SMART
HELICc 495 600 5.61e-16 SMART
HA2 662 753 2.23e-26 SMART
Pfam:OB_NTP_bind 792 910 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192223
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,786 D32G probably benign Het
Abca7 T G 10: 80,008,967 F1508V probably damaging Het
Angptl7 T A 4: 148,500,214 K26* probably null Het
BC048507 T C 13: 67,863,630 I42T probably benign Het
Cald1 A G 6: 34,757,996 probably benign Het
Ces5a A G 8: 93,528,504 F187S probably damaging Het
Chd3 A G 11: 69,360,616 Y530H probably damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Cst9 G T 2: 148,835,225 probably null Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Dcaf10 T C 4: 45,373,957 S461P probably benign Het
Doxl2 A G 6: 48,976,424 T428A probably benign Het
Eps8l3 T C 3: 107,891,328 I510T probably damaging Het
Gab2 A G 7: 97,223,552 E54G probably benign Het
Gsdme A G 6: 50,229,324 C180R probably damaging Het
Hesx1 A G 14: 27,000,642 probably benign Het
Il5ra G A 6: 106,741,235 P86L probably benign Het
Jakmip1 A G 5: 37,091,527 K177R probably damaging Het
Larp4b T C 13: 9,166,311 probably benign Het
Lrrc42 A T 4: 107,239,114 D40E probably damaging Het
Mefv G A 16: 3,715,694 R238* probably null Het
Mroh9 A T 1: 163,056,769 M400K probably damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr204 A C 16: 59,315,404 M1R probably null Het
Olfr527 T G 7: 140,336,387 F175C probably damaging Het
Plec C G 15: 76,188,761 G631R probably damaging Het
Polr3b A G 10: 84,628,280 K35E probably benign Het
Ppef2 T C 5: 92,239,094 E328G probably benign Het
Rogdi G T 16: 5,011,662 Q90K probably damaging Het
Rtn1 C A 12: 72,223,389 R116L probably damaging Het
Sept14 T C 5: 129,699,022 H31R probably benign Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Slc10a5 A T 3: 10,334,457 I381N probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Tm9sf1 T A 14: 55,641,114 T274S probably benign Het
Tpgs1 A G 10: 79,669,615 E69G probably damaging Het
Trpv5 T C 6: 41,653,231 S642G possibly damaging Het
Ttn A C 2: 76,802,317 I12385S probably damaging Het
Ube2e2 T C 14: 18,630,321 D137G possibly damaging Het
Ubr4 T C 4: 139,406,536 Y748H probably benign Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vcp T A 4: 42,996,315 I16F probably damaging Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Other mutations in Dhx36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dhx36 APN 3 62470558 utr 3 prime probably benign
IGL00538:Dhx36 APN 3 62501045 missense probably benign 0.04
IGL00706:Dhx36 APN 3 62496842 missense probably damaging 1.00
IGL02040:Dhx36 APN 3 62501015 missense probably benign
IGL02141:Dhx36 APN 3 62493889 missense probably benign 0.25
IGL02514:Dhx36 APN 3 62500898 missense possibly damaging 0.63
IGL02540:Dhx36 APN 3 62506888 missense probably benign 0.07
IGL02629:Dhx36 APN 3 62506734 missense probably benign 0.01
IGL02858:Dhx36 APN 3 62477376 splice site probably benign
IGL03305:Dhx36 APN 3 62500836 nonsense probably null
R0002:Dhx36 UTSW 3 62480839 missense probably damaging 1.00
R0002:Dhx36 UTSW 3 62480839 missense probably damaging 1.00
R0021:Dhx36 UTSW 3 62477595 missense possibly damaging 0.66
R0021:Dhx36 UTSW 3 62477595 missense possibly damaging 0.66
R0671:Dhx36 UTSW 3 62493741 missense possibly damaging 0.96
R0735:Dhx36 UTSW 3 62472729 missense probably benign 0.00
R0782:Dhx36 UTSW 3 62506714 splice site probably benign
R1725:Dhx36 UTSW 3 62506939 start codon destroyed probably benign 0.01
R1951:Dhx36 UTSW 3 62484273 missense probably damaging 0.99
R1959:Dhx36 UTSW 3 62479385 missense probably benign 0.01
R2257:Dhx36 UTSW 3 62477643 missense probably damaging 1.00
R2397:Dhx36 UTSW 3 62498097 missense probably benign 0.00
R2484:Dhx36 UTSW 3 62472815 missense probably damaging 0.96
R2973:Dhx36 UTSW 3 62495498 missense possibly damaging 0.56
R3617:Dhx36 UTSW 3 62472007 missense possibly damaging 0.96
R3617:Dhx36 UTSW 3 62487060 missense probably benign 0.01
R3725:Dhx36 UTSW 3 62488222 splice site probably benign
R3898:Dhx36 UTSW 3 62492369 missense probably damaging 0.98
R4332:Dhx36 UTSW 3 62484991 missense probably damaging 1.00
R4359:Dhx36 UTSW 3 62475278 missense probably benign 0.05
R4493:Dhx36 UTSW 3 62488504 intron probably benign
R4652:Dhx36 UTSW 3 62500998 missense probably benign 0.01
R4866:Dhx36 UTSW 3 62472777 missense probably damaging 1.00
R4884:Dhx36 UTSW 3 62484260 missense probably damaging 1.00
R4960:Dhx36 UTSW 3 62496859 missense probably damaging 1.00
R5083:Dhx36 UTSW 3 62471999 missense probably benign 0.17
R5162:Dhx36 UTSW 3 62493780 missense probably damaging 1.00
R5815:Dhx36 UTSW 3 62493755 missense probably damaging 1.00
R6090:Dhx36 UTSW 3 62496820 missense probably damaging 0.98
R6392:Dhx36 UTSW 3 62494369 missense probably benign 0.00
R6433:Dhx36 UTSW 3 62484974 missense probably damaging 1.00
R6504:Dhx36 UTSW 3 62488639 missense probably benign
R6615:Dhx36 UTSW 3 62488917 missense probably benign
R6672:Dhx36 UTSW 3 62495536 missense probably damaging 1.00
R6672:Dhx36 UTSW 3 62500879 missense probably benign 0.00
R7172:Dhx36 UTSW 3 62501015 missense probably benign
R7302:Dhx36 UTSW 3 62479393 missense probably benign
R7487:Dhx36 UTSW 3 62484202 missense possibly damaging 0.91
R7515:Dhx36 UTSW 3 62472087 missense probably benign 0.45
R7531:Dhx36 UTSW 3 62484968 missense probably damaging 1.00
R7579:Dhx36 UTSW 3 62480873 missense possibly damaging 0.64
R7726:Dhx36 UTSW 3 62488968 missense probably benign 0.01
R7874:Dhx36 UTSW 3 62488631 missense probably benign
R7957:Dhx36 UTSW 3 62488631 missense probably benign
R8056:Dhx36 UTSW 3 62488591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAAGGGTATGCTGAGATGC -3'
(R):5'- AGCTTCAGGTACCTCAGACTTTAG -3'

Sequencing Primer
(F):5'- AGAGAACTGACTCCTGCAGTTTGTC -3'
(R):5'- TCAGGTACCTCAGACTTTAGTATTTC -3'
Posted On2014-12-29