Incidental Mutation 'R2973:Ppef2'
ID 255276
Institutional Source Beutler Lab
Gene Symbol Ppef2
Ensembl Gene ENSMUSG00000029410
Gene Name protein phosphatase, EF hand calcium-binding domain 2
Synonyms
MMRRC Submission 040526-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2973 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 92226679-92256278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92239094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 328 (E328G)
Ref Sequence ENSEMBL: ENSMUSP00000144157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]
AlphaFold O35385
Predicted Effect probably benign
Transcript: ENSMUST00000031359
AA Change: E328G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410
AA Change: E328G

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201130
AA Change: E328G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410
AA Change: E328G

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,786 D32G probably benign Het
Abca7 T G 10: 80,008,967 F1508V probably damaging Het
Angptl7 T A 4: 148,500,214 K26* probably null Het
BC048507 T C 13: 67,863,630 I42T probably benign Het
Cald1 A G 6: 34,757,996 probably benign Het
Ces5a A G 8: 93,528,504 F187S probably damaging Het
Chd3 A G 11: 69,360,616 Y530H probably damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Cst9 G T 2: 148,835,225 probably null Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Dcaf10 T C 4: 45,373,957 S461P probably benign Het
Dhx36 T A 3: 62,495,495 N279Y probably benign Het
Dhx36 C G 3: 62,495,498 G278R possibly damaging Het
Doxl2 A G 6: 48,976,424 T428A probably benign Het
Eps8l3 T C 3: 107,891,328 I510T probably damaging Het
Gab2 A G 7: 97,223,552 E54G probably benign Het
Gsdme A G 6: 50,229,324 C180R probably damaging Het
Hesx1 A G 14: 27,000,642 probably benign Het
Il5ra G A 6: 106,741,235 P86L probably benign Het
Jakmip1 A G 5: 37,091,527 K177R probably damaging Het
Larp4b T C 13: 9,166,311 probably benign Het
Lrrc42 A T 4: 107,239,114 D40E probably damaging Het
Mefv G A 16: 3,715,694 R238* probably null Het
Mroh9 A T 1: 163,056,769 M400K probably damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr204 A C 16: 59,315,404 M1R probably null Het
Olfr527 T G 7: 140,336,387 F175C probably damaging Het
Plec C G 15: 76,188,761 G631R probably damaging Het
Polr3b A G 10: 84,628,280 K35E probably benign Het
Rogdi G T 16: 5,011,662 Q90K probably damaging Het
Rtn1 C A 12: 72,223,389 R116L probably damaging Het
Sept14 T C 5: 129,699,022 H31R probably benign Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Slc10a5 A T 3: 10,334,457 I381N probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Tm9sf1 T A 14: 55,641,114 T274S probably benign Het
Tpgs1 A G 10: 79,669,615 E69G probably damaging Het
Trpv5 T C 6: 41,653,231 S642G possibly damaging Het
Ttn A C 2: 76,802,317 I12385S probably damaging Het
Ube2e2 T C 14: 18,630,321 D137G possibly damaging Het
Ubr4 T C 4: 139,406,536 Y748H probably benign Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vcp T A 4: 42,996,315 I16F probably damaging Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Other mutations in Ppef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ppef2 APN 5 92234237 missense probably damaging 1.00
IGL01105:Ppef2 APN 5 92249196 missense possibly damaging 0.91
IGL01613:Ppef2 APN 5 92235820 missense probably benign 0.01
IGL01793:Ppef2 APN 5 92246756 missense probably damaging 1.00
IGL02529:Ppef2 APN 5 92244737 missense probably damaging 1.00
IGL02702:Ppef2 APN 5 92231819 missense probably benign 0.01
IGL02992:Ppef2 APN 5 92235900 nonsense probably null
IGL02995:Ppef2 APN 5 92235900 nonsense probably null
IGL02996:Ppef2 APN 5 92235900 nonsense probably null
IGL03169:Ppef2 APN 5 92235900 nonsense probably null
IGL02991:Ppef2 UTSW 5 92235900 nonsense probably null
R0494:Ppef2 UTSW 5 92253093 splice site probably benign
R0659:Ppef2 UTSW 5 92230509 missense probably damaging 1.00
R0781:Ppef2 UTSW 5 92244830 missense probably benign 0.39
R1162:Ppef2 UTSW 5 92253121 missense probably benign 0.00
R1870:Ppef2 UTSW 5 92250512 missense probably damaging 1.00
R2212:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3412:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3413:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3745:Ppef2 UTSW 5 92239151 splice site probably benign
R4878:Ppef2 UTSW 5 92228740 splice site probably null
R5027:Ppef2 UTSW 5 92234291 missense probably damaging 1.00
R5156:Ppef2 UTSW 5 92244602 critical splice donor site probably null
R5316:Ppef2 UTSW 5 92235811 missense probably benign 0.00
R5590:Ppef2 UTSW 5 92239139 missense probably damaging 0.99
R5773:Ppef2 UTSW 5 92250561 missense probably damaging 1.00
R5881:Ppef2 UTSW 5 92250529 nonsense probably null
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6182:Ppef2 UTSW 5 92227066 missense probably damaging 1.00
R6335:Ppef2 UTSW 5 92235754 missense probably damaging 1.00
R6645:Ppef2 UTSW 5 92230461 missense probably benign 0.02
R7448:Ppef2 UTSW 5 92228704 missense probably damaging 1.00
R7576:Ppef2 UTSW 5 92253134 missense possibly damaging 0.87
R7968:Ppef2 UTSW 5 92249163 missense probably damaging 0.99
R7988:Ppef2 UTSW 5 92238982 missense probably benign 0.00
R8200:Ppef2 UTSW 5 92245392 missense probably benign 0.13
R8212:Ppef2 UTSW 5 92228665 missense possibly damaging 0.87
R9687:Ppef2 UTSW 5 92238887 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTGTTCCAGTTCCAGGTC -3'
(R):5'- CAGAACAGTAGTCTGAAAGGACTTAC -3'

Sequencing Primer
(F):5'- CGCCGGGATAGCTCCTTG -3'
(R):5'- GTAGTCTGAAAGGACTTACCATTTC -3'
Posted On 2014-12-29