Incidental Mutation 'R2973:Olfr204'
ID255301
Institutional Source Beutler Lab
Gene Symbol Olfr204
Ensembl Gene ENSMUSG00000095928
Gene Nameolfactory receptor 204
SynonymsGA_x54KRFPKG5P-55529713-55528796, MOR182-3
MMRRC Submission 040526-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2973 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59310206-59318248 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 59315404 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000151176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072517] [ENSMUST00000207927] [ENSMUST00000216261]
Predicted Effect probably null
Transcript: ENSMUST00000072517
AA Change: M1R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072332
Gene: ENSMUSG00000095928
AA Change: M1R

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 299 2.3e-9 PFAM
Pfam:7tm_1 40 289 3.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207927
AA Change: M1R
Predicted Effect probably null
Transcript: ENSMUST00000216261
AA Change: M1R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,786 D32G probably benign Het
Abca7 T G 10: 80,008,967 F1508V probably damaging Het
Angptl7 T A 4: 148,500,214 K26* probably null Het
BC048507 T C 13: 67,863,630 I42T probably benign Het
Cald1 A G 6: 34,757,996 probably benign Het
Ces5a A G 8: 93,528,504 F187S probably damaging Het
Chd3 A G 11: 69,360,616 Y530H probably damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Cst9 G T 2: 148,835,225 probably null Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Dcaf10 T C 4: 45,373,957 S461P probably benign Het
Dhx36 T A 3: 62,495,495 N279Y probably benign Het
Dhx36 C G 3: 62,495,498 G278R possibly damaging Het
Doxl2 A G 6: 48,976,424 T428A probably benign Het
Eps8l3 T C 3: 107,891,328 I510T probably damaging Het
Gab2 A G 7: 97,223,552 E54G probably benign Het
Gsdme A G 6: 50,229,324 C180R probably damaging Het
Hesx1 A G 14: 27,000,642 probably benign Het
Il5ra G A 6: 106,741,235 P86L probably benign Het
Jakmip1 A G 5: 37,091,527 K177R probably damaging Het
Larp4b T C 13: 9,166,311 probably benign Het
Lrrc42 A T 4: 107,239,114 D40E probably damaging Het
Mefv G A 16: 3,715,694 R238* probably null Het
Mroh9 A T 1: 163,056,769 M400K probably damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr527 T G 7: 140,336,387 F175C probably damaging Het
Plec C G 15: 76,188,761 G631R probably damaging Het
Polr3b A G 10: 84,628,280 K35E probably benign Het
Ppef2 T C 5: 92,239,094 E328G probably benign Het
Rogdi G T 16: 5,011,662 Q90K probably damaging Het
Rtn1 C A 12: 72,223,389 R116L probably damaging Het
Sept14 T C 5: 129,699,022 H31R probably benign Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Slc10a5 A T 3: 10,334,457 I381N probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Tm9sf1 T A 14: 55,641,114 T274S probably benign Het
Tpgs1 A G 10: 79,669,615 E69G probably damaging Het
Trpv5 T C 6: 41,653,231 S642G possibly damaging Het
Ttn A C 2: 76,802,317 I12385S probably damaging Het
Ube2e2 T C 14: 18,630,321 D137G possibly damaging Het
Ubr4 T C 4: 139,406,536 Y748H probably benign Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vcp T A 4: 42,996,315 I16F probably damaging Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Other mutations in Olfr204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Olfr204 APN 16 59314528 missense probably damaging 1.00
IGL01915:Olfr204 APN 16 59315110 missense probably damaging 1.00
R0265:Olfr204 UTSW 16 59315071 missense probably damaging 1.00
R0532:Olfr204 UTSW 16 59314601 missense probably benign 0.00
R1719:Olfr204 UTSW 16 59314706 nonsense probably null
R1864:Olfr204 UTSW 16 59315015 missense probably damaging 1.00
R1889:Olfr204 UTSW 16 59314963 missense probably damaging 0.98
R1925:Olfr204 UTSW 16 59314664 missense probably damaging 1.00
R3078:Olfr204 UTSW 16 59314726 missense probably benign
R3819:Olfr204 UTSW 16 59315071 missense probably damaging 1.00
R4036:Olfr204 UTSW 16 59314750 missense probably benign
R4698:Olfr204 UTSW 16 59315357 missense probably damaging 1.00
R4930:Olfr204 UTSW 16 59314873 missense probably damaging 1.00
R5457:Olfr204 UTSW 16 59314850 missense probably benign 0.12
R6597:Olfr204 UTSW 16 59315350 missense probably benign 0.00
R7341:Olfr204 UTSW 16 59315149 missense possibly damaging 0.69
R7512:Olfr204 UTSW 16 59315027 missense probably damaging 0.99
R7702:Olfr204 UTSW 16 59314634 missense probably damaging 1.00
R8132:Olfr204 UTSW 16 59314544 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCAAAGGCCAAATTTCCAAGG -3'
(R):5'- TCAGGTGAATCGATGTCTCTGATC -3'

Sequencing Primer
(F):5'- CCAAATTTCCAAGGAAAAGGTACATG -3'
(R):5'- TGGTCTACAGAATGAGTTCCAG -3'
Posted On2014-12-29