Incidental Mutation 'R2974:Gm13757'
ID255309
Institutional Source Beutler Lab
Gene Symbol Gm13757
Ensembl Gene ENSMUSG00000090097
Gene Namepredicted gene 13757
Synonyms
MMRRC Submission 040527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2974 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88442814-88449131 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 88446574 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 121 (C121*)
Ref Sequence ENSEMBL: ENSMUSP00000136580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102619] [ENSMUST00000126038] [ENSMUST00000179450]
Predicted Effect probably null
Transcript: ENSMUST00000102619
AA Change: C121*
SMART Domains Protein: ENSMUSP00000099679
Gene: ENSMUSG00000075125
AA Change: C121*

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 285 7.2e-26 PFAM
Pfam:7tm_4 137 278 3.5e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126038
AA Change: C121*
Predicted Effect probably null
Transcript: ENSMUST00000179450
AA Change: C121*
SMART Domains Protein: ENSMUSP00000136580
Gene: ENSMUSG00000090097
AA Change: C121*

DomainStartEndE-ValueType
Pfam:7tm_4 26 303 1.4e-49 PFAM
Pfam:7tm_1 39 285 1.5e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,786 D32G probably benign Het
Abca7 T G 10: 80,008,967 F1508V probably damaging Het
BC048507 T C 13: 67,863,630 I42T probably benign Het
Cop1 A G 1: 159,324,929 H583R possibly damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Ctu1 A G 7: 43,675,650 probably benign Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Depdc5 T C 5: 32,934,017 probably null Het
Dnah14 A T 1: 181,755,241 probably null Het
Doxl2 A G 6: 48,976,424 T428A probably benign Het
Dpp10 A G 1: 123,411,705 probably benign Het
Gsdme A G 6: 50,229,324 C180R probably damaging Het
Gse1 C A 8: 120,570,897 probably benign Het
Med15 T C 16: 17,652,711 Y744C probably damaging Het
Nlrp4d A G 7: 10,378,440 probably benign Het
Nyap2 C T 1: 81,191,770 R81* probably null Het
Olfr948 T C 9: 39,318,996 N206S probably damaging Het
Phax T A 18: 56,573,062 M8K probably benign Het
Plec C G 15: 76,188,761 G631R probably damaging Het
Rgs3 A T 4: 62,640,720 T476S probably damaging Het
Rogdi G T 16: 5,011,662 Q90K probably damaging Het
Rxrg G A 1: 167,639,146 R422H probably damaging Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Simc1 A G 13: 54,550,461 D397G probably damaging Het
Slc25a27 T C 17: 43,653,371 N203D probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Tnip1 C T 11: 54,933,983 probably benign Het
Tpgs1 A G 10: 79,669,615 E69G probably damaging Het
Trpv5 T C 6: 41,653,231 S642G possibly damaging Het
Ube2d2a T A 18: 35,800,172 D87E possibly damaging Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Vmn2r77 T C 7: 86,803,685 Y537H probably benign Het
Other mutations in Gm13757
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0241:Gm13757 UTSW 2 88446545 missense possibly damaging 0.48
R0627:Gm13757 UTSW 2 88446219 missense probably damaging 1.00
R0634:Gm13757 UTSW 2 88446617 missense probably benign 0.10
R1305:Gm13757 UTSW 2 88446302 nonsense probably null
R1353:Gm13757 UTSW 2 88446551 missense probably benign 0.42
R1765:Gm13757 UTSW 2 88446023 missense probably damaging 1.00
R1974:Gm13757 UTSW 2 88446509 missense probably damaging 0.97
R1990:Gm13757 UTSW 2 88446689 missense probably damaging 1.00
R2196:Gm13757 UTSW 2 88446710 missense probably benign 0.10
R4794:Gm13757 UTSW 2 88446347 missense probably benign 0.12
R5495:Gm13757 UTSW 2 88446057 missense probably benign 0.03
R5771:Gm13757 UTSW 2 88446308 missense possibly damaging 0.94
R6654:Gm13757 UTSW 2 88446672 missense possibly damaging 0.80
R6756:Gm13757 UTSW 2 88446734 missense possibly damaging 0.78
R8070:Gm13757 UTSW 2 88446659 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCAACCATGAGGACACC -3'
(R):5'- AGCATCTATGGACATCTGCTATACC -3'

Sequencing Primer
(F):5'- CACCAATGATGTAGGTATCAGTGC -3'
(R):5'- CTCCTGTGTGACACCCAAATTGATTG -3'
Posted On2014-12-29