Mutagenetix > Incidental Mutations

Incidental Mutation 'R0319:Klhl9'

25531

Institutional Source

Beutler Lab

Gene Symbol

Klhl9

Ensembl Gene

ENSMUSG00000070923

Gene Name

kelch-like 9

Synonyms

C530050O22Rik

MMRRC Submission

038529-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0319 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88718292-88722465 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 88720454 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 517 (Y517N)

Ref Sequence

ENSEMBL: ENSMUSP00000092602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094993] [ENSMUST00000181601]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094993
AA Change: Y517N

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000092602
Gene: ENSMUSG00000070923
AA Change: Y517N

Domain	Start	End	E-Value	Type
BTB	50	149	7.21e-22	SMART
BACK	154	255	3.93e-27	SMART
low complexity region	276	287	N/A	INTRINSIC
Kelch	299	347	1.13e-2	SMART
Kelch	348	399	1.92e-5	SMART
Kelch	400	446	1.59e-11	SMART
Kelch	447	493	2.61e-7	SMART
Kelch	494	545	1.58e-6	SMART
Kelch	546	594	1.43e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000181601

SMART Domains

Protein: ENSMUSP00000137773
Gene: ENSMUSG00000097078

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC

Meta Mutation Damage Score

0.1921

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 95.0%
20x: 89.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain, a BACK domain and six C-terminal kelch repeats. The encoded protein is a component of a complex with cullin 3-based E3 ligase, which plays a role in mitosis. This protein complex is a cell cycle regulator, and functions in the organization and integrity of the spindle midzone in anaphase and the completion of cytokinesis. The complex is required for the removal of the chromosomal passenger protein aurora B from mitotic chromosomes. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	A	C	7: 128,237,190	V77G	probably benign	Het
Abcb1b	A	G	5: 8,827,428	R663G	probably benign	Het
Acly	A	G	11: 100,504,982	V404A	probably damaging	Het
Actg2	T	A	6: 83,520,743	I103F	probably damaging	Het
Anapc5	A	G	5: 122,818,856	V120A	probably damaging	Het
Ankk1	T	G	9: 49,416,071	T603P	probably damaging	Het
Ankmy2	T	C	12: 36,165,899	S33P	possibly damaging	Het
Arhgef19	A	T	4: 141,256,399	T748S	possibly damaging	Het
Atad5	T	A	11: 80,120,790		probably benign	Het
Atxn10	T	C	15: 85,365,282	L105P	probably damaging	Het
Cacna1s	T	C	1: 136,070,717	V161A	probably damaging	Het
Col6a3	T	C	1: 90,807,704	E741G	possibly damaging	Het
Cpne9	G	A	6: 113,294,693	G338E	probably damaging	Het
Cyp3a13	G	A	5: 137,898,862	P397S	probably damaging	Het
Dbn1	C	T	13: 55,474,916	E585K	probably damaging	Het
Dirc2	T	C	16: 35,750,514	D140G	probably benign	Het
Draxin	A	G	4: 148,115,972	L7P	probably benign	Het
Exosc7	T	A	9: 123,130,960		probably benign	Het
Far2	A	G	6: 148,157,470	E218G	probably damaging	Het
Ggps1	A	C	13: 14,053,877	N240K	possibly damaging	Het
Kcnip1	T	C	11: 33,651,529		probably benign	Het
Kcnv2	A	T	19: 27,324,024	Y425F	probably benign	Het
Kdelr2	T	A	5: 143,412,517	F40I	probably damaging	Het
Kdm1b	C	T	13: 47,053,719	P173L	probably benign	Het
Kif20b	G	A	19: 34,947,732		probably benign	Het
Lgals3bp	A	G	11: 118,393,521	S411P	probably damaging	Het
Lmo3	G	A	6: 138,377,311	T85M	probably damaging	Het
Lvrn	C	A	18: 46,864,753	T256N	probably damaging	Het
Malt1	T	C	18: 65,462,915		probably null	Het
Mgst1	A	G	6: 138,156,157	I157V	possibly damaging	Het
Mob3a	A	T	10: 80,689,985	V164E	possibly damaging	Het
Mprip	T	A	11: 59,697,038		probably benign	Het
Mst1	A	G	9: 108,082,513	N276S	probably benign	Het
Olfr1437	A	T	19: 12,322,316	C170*	probably null	Het
P3h2	T	A	16: 25,970,931	I529F	possibly damaging	Het
Pikfyve	T	A	1: 65,246,331	S865T	probably benign	Het
Rcbtb2	G	A	14: 73,178,469	R474Q	probably benign	Het
Rpl27	G	A	11: 101,443,495		probably benign	Het
Rtp1	G	A	16: 23,431,460	E192K	probably damaging	Het
Sgk2	T	C	2: 162,995,672		probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Spdl1	T	C	11: 34,823,520	N114S	possibly damaging	Het
Syne2	C	T	12: 76,064,162	R5756W	probably damaging	Het
Tor1aip1	T	C	1: 156,007,181	E307G	probably damaging	Het
Tpd52	T	C	3: 8,953,689	T44A	probably benign	Het
Trim67	A	T	8: 124,823,227	Y532F	probably damaging	Het
Ttll9	C	A	2: 153,000,098		probably null	Het
Ush2a	T	C	1: 188,948,374		probably benign	Het
Vcam1	T	C	3: 116,116,060	I539M	probably benign	Het
Vmn1r19	T	A	6: 57,404,615	M51K	possibly damaging	Het
Vmn2r61	T	A	7: 42,300,517	M787K	probably damaging	Het
Xdh	T	A	17: 73,906,101		probably benign	Het
Zfp109	A	T	7: 24,234,470	V8E	probably damaging	Het
Zfp595	G	A	13: 67,316,513	A562V	possibly damaging	Het
Zfp759	A	G	13: 67,140,292	T636A	probably benign	Het

Other mutations in Klhl9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00588:Klhl9	APN	4	88720819	missense	probably damaging	1.00
IGL00592:Klhl9	APN	4	88721141	missense	probably damaging	0.99
IGL01986:Klhl9	APN	4	88721779	missense	probably damaging	0.99
IGL02364:Klhl9	APN	4	88721170	missense	probably damaging	1.00
IGL02994:Klhl9	APN	4	88721197	nonsense	probably null
minnow	UTSW	4	88721606	nonsense	probably null
R0360:Klhl9	UTSW	4	88720290	missense	probably benign	0.05
R0364:Klhl9	UTSW	4	88720290	missense	probably benign	0.05
R0693:Klhl9	UTSW	4	88720290	missense	probably benign	0.05
R0961:Klhl9	UTSW	4	88721737	missense	probably benign	0.16
R1521:Klhl9	UTSW	4	88721993	missense	probably benign	0.03
R2891:Klhl9	UTSW	4	88720970	missense	probably benign	0.02
R3762:Klhl9	UTSW	4	88721593	missense	possibly damaging	0.93
R4584:Klhl9	UTSW	4	88721907	missense	probably damaging	1.00
R4678:Klhl9	UTSW	4	88720924	missense	probably damaging	1.00
R4888:Klhl9	UTSW	4	88721945	missense	probably benign	0.01
R5030:Klhl9	UTSW	4	88720534	missense	possibly damaging	0.96
R5082:Klhl9	UTSW	4	88721385	missense	probably damaging	0.97
R6466:Klhl9	UTSW	4	88721162	missense	probably benign	0.00
R7032:Klhl9	UTSW	4	88721606	nonsense	probably null
R7532:Klhl9	UTSW	4	88720853	missense	possibly damaging	0.79
R7602:Klhl9	UTSW	4	88722409	start gained	probably benign
R7618:Klhl9	UTSW	4	88720535	missense	possibly damaging	0.80
R7879:Klhl9	UTSW	4	88720338	missense	probably damaging	1.00
R7909:Klhl9	UTSW	4	88721001	missense	probably benign	0.12
R7962:Klhl9	UTSW	4	88720338	missense	probably damaging	1.00
R7990:Klhl9	UTSW	4	88721001	missense	probably benign	0.12
X0063:Klhl9	UTSW	4	88721951	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGGACAATTTCTACCATGCACCG -3'
(R):5'- ACGTTGCAAAGATGAGTGAACCCC -3'

Sequencing Primer
(F):5'- CCGGTTATTCCAAGAATATCCAC -3'
(R):5'- GATGAGTGAACCCCACTATGGC -3'

Posted On

2013-04-16