Incidental Mutation 'R2974:Trpv5'
ID255315
Institutional Source Beutler Lab
Gene Symbol Trpv5
Ensembl Gene ENSMUSG00000036899
Gene Nametransient receptor potential cation channel, subfamily V, member 5
SynonymsECaC1, CaT2
MMRRC Submission 040527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R2974 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41652173-41680769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41653231 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 642 (S642G)
Ref Sequence ENSEMBL: ENSMUSP00000141421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031901] [ENSMUST00000193503]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031901
AA Change: S691G

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031901
Gene: ENSMUSG00000036899
AA Change: S691G

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 2.3e0 SMART
ANK 110 139 4.56e-4 SMART
ANK 156 185 1.85e-4 SMART
Blast:ANK 189 217 3e-10 BLAST
ANK 232 261 3.07e2 SMART
Pfam:Ion_trans 321 583 1.8e-19 PFAM
low complexity region 676 691 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193503
AA Change: S642G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141421
Gene: ENSMUSG00000036899
AA Change: S642G

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 1.5e-2 SMART
ANK 110 139 2.8e-6 SMART
ANK 156 185 1.2e-6 SMART
Blast:ANK 189 217 4e-10 BLAST
transmembrane domain 274 296 N/A INTRINSIC
Pfam:Ion_trans 335 522 2.7e-12 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit increased calcium excretion and reduced bone thickenss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,786 D32G probably benign Het
Abca7 T G 10: 80,008,967 F1508V probably damaging Het
BC048507 T C 13: 67,863,630 I42T probably benign Het
Cop1 A G 1: 159,324,929 H583R possibly damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Ctu1 A G 7: 43,675,650 probably benign Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Depdc5 T C 5: 32,934,017 probably null Het
Dnah14 A T 1: 181,755,241 probably null Het
Doxl2 A G 6: 48,976,424 T428A probably benign Het
Dpp10 A G 1: 123,411,705 probably benign Het
Gm13757 A T 2: 88,446,574 C121* probably null Het
Gsdme A G 6: 50,229,324 C180R probably damaging Het
Gse1 C A 8: 120,570,897 probably benign Het
Med15 T C 16: 17,652,711 Y744C probably damaging Het
Nlrp4d A G 7: 10,378,440 probably benign Het
Nyap2 C T 1: 81,191,770 R81* probably null Het
Olfr948 T C 9: 39,318,996 N206S probably damaging Het
Phax T A 18: 56,573,062 M8K probably benign Het
Plec C G 15: 76,188,761 G631R probably damaging Het
Rgs3 A T 4: 62,640,720 T476S probably damaging Het
Rogdi G T 16: 5,011,662 Q90K probably damaging Het
Rxrg G A 1: 167,639,146 R422H probably damaging Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Simc1 A G 13: 54,550,461 D397G probably damaging Het
Slc25a27 T C 17: 43,653,371 N203D probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Tnip1 C T 11: 54,933,983 probably benign Het
Tpgs1 A G 10: 79,669,615 E69G probably damaging Het
Ube2d2a T A 18: 35,800,172 D87E possibly damaging Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Vmn2r77 T C 7: 86,803,685 Y537H probably benign Het
Other mutations in Trpv5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Trpv5 APN 6 41675375 missense possibly damaging 0.87
IGL01704:Trpv5 APN 6 41653258 missense possibly damaging 0.88
IGL01860:Trpv5 APN 6 41660295 missense probably damaging 1.00
IGL01950:Trpv5 APN 6 41675978 missense probably benign 0.09
Firesign UTSW 6 41658042 missense probably damaging 1.00
gingame UTSW 6 41670961 missense probably damaging 1.00
R0515:Trpv5 UTSW 6 41674211 intron probably benign
R1581:Trpv5 UTSW 6 41653140 missense probably damaging 1.00
R1633:Trpv5 UTSW 6 41675920 nonsense probably null
R1658:Trpv5 UTSW 6 41674282 missense probably damaging 1.00
R1677:Trpv5 UTSW 6 41657797 missense probably benign 0.44
R1955:Trpv5 UTSW 6 41657937 missense probably damaging 1.00
R2008:Trpv5 UTSW 6 41659728 critical splice acceptor site probably null
R2331:Trpv5 UTSW 6 41659968 missense probably damaging 1.00
R2519:Trpv5 UTSW 6 41674350 missense probably damaging 0.99
R2973:Trpv5 UTSW 6 41653231 missense possibly damaging 0.81
R3877:Trpv5 UTSW 6 41660343 missense probably benign 0.10
R3923:Trpv5 UTSW 6 41653249 missense probably benign 0.00
R4056:Trpv5 UTSW 6 41659705 missense probably damaging 1.00
R4396:Trpv5 UTSW 6 41657896 missense probably benign 0.00
R4757:Trpv5 UTSW 6 41653214 missense probably damaging 0.98
R5013:Trpv5 UTSW 6 41659713 missense probably damaging 1.00
R5039:Trpv5 UTSW 6 41675945 missense possibly damaging 0.73
R5330:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R5331:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R6270:Trpv5 UTSW 6 41674359 missense possibly damaging 0.94
R6405:Trpv5 UTSW 6 41674668 missense probably damaging 1.00
R6575:Trpv5 UTSW 6 41675969 missense probably benign
R6669:Trpv5 UTSW 6 41658042 missense probably damaging 1.00
R6681:Trpv5 UTSW 6 41653354 missense probably damaging 0.97
R6817:Trpv5 UTSW 6 41658007 missense possibly damaging 0.65
R7021:Trpv5 UTSW 6 41653270 missense probably benign 0.00
R7069:Trpv5 UTSW 6 41675960 missense possibly damaging 0.94
R7161:Trpv5 UTSW 6 41660536 nonsense probably null
R7241:Trpv5 UTSW 6 41675308 nonsense probably null
R7505:Trpv5 UTSW 6 41674656 missense probably damaging 0.99
R7806:Trpv5 UTSW 6 41674933 missense probably damaging 0.99
R8060:Trpv5 UTSW 6 41674531 nonsense probably null
Z1177:Trpv5 UTSW 6 41674321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCAAAGCAGCTCTCTTC -3'
(R):5'- TTGAACACCACCAGGAGCAG -3'

Sequencing Primer
(F):5'- AAAGCAGCTCTCTTCTCCCTG -3'
(R):5'- GGAGCAGAATCCTTATCGAGTACTTC -3'
Posted On2014-12-29