Incidental Mutation 'R2974:Tpgs1'
ID255323
Institutional Source Beutler Lab
Gene Symbol Tpgs1
Ensembl Gene ENSMUSG00000020308
Gene Nametubulin polyglutamylase complex subunit 1
SynonymsGtrgeo22, Gm16517
MMRRC Submission 040527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R2974 (G1)
Quality Score116
Status Validated
Chromosome10
Chromosomal Location79669369-79676127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79669615 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 69 (E69G)
Ref Sequence ENSEMBL: ENSMUSP00000020552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020552] [ENSMUST00000020554] [ENSMUST00000217748]
Predicted Effect probably damaging
Transcript: ENSMUST00000020552
AA Change: E69G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020552
Gene: ENSMUSG00000020308
AA Change: E69G

DomainStartEndE-ValueType
low complexity region 94 114 N/A INTRINSIC
Blast:UBCc 125 156 9e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000020554
SMART Domains Protein: ENSMUSP00000020554
Gene: ENSMUSG00000020310

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:ICAM_N 21 114 7.3e-8 PFAM
Pfam:Adhes-Ig_like 110 220 2.4e-57 PFAM
Blast:IG_like 278 354 3e-14 BLAST
transmembrane domain 366 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220175
Meta Mutation Damage Score 0.3439 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Male mice homozygous for a gene trapped allele are sterile due to abnormal development of the spermatid flagellum. Adult males display a striking deficit in intermale aggression and reduced body fat, not due to an altered resting metabolic rate or hypophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,786 D32G probably benign Het
Abca7 T G 10: 80,008,967 F1508V probably damaging Het
BC048507 T C 13: 67,863,630 I42T probably benign Het
Cop1 A G 1: 159,324,929 H583R possibly damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Ctu1 A G 7: 43,675,650 probably benign Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Depdc5 T C 5: 32,934,017 probably null Het
Dnah14 A T 1: 181,755,241 probably null Het
Doxl2 A G 6: 48,976,424 T428A probably benign Het
Dpp10 A G 1: 123,411,705 probably benign Het
Gm13757 A T 2: 88,446,574 C121* probably null Het
Gsdme A G 6: 50,229,324 C180R probably damaging Het
Gse1 C A 8: 120,570,897 probably benign Het
Med15 T C 16: 17,652,711 Y744C probably damaging Het
Nlrp4d A G 7: 10,378,440 probably benign Het
Nyap2 C T 1: 81,191,770 R81* probably null Het
Olfr948 T C 9: 39,318,996 N206S probably damaging Het
Phax T A 18: 56,573,062 M8K probably benign Het
Plec C G 15: 76,188,761 G631R probably damaging Het
Rgs3 A T 4: 62,640,720 T476S probably damaging Het
Rogdi G T 16: 5,011,662 Q90K probably damaging Het
Rxrg G A 1: 167,639,146 R422H probably damaging Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Simc1 A G 13: 54,550,461 D397G probably damaging Het
Slc25a27 T C 17: 43,653,371 N203D probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Tnip1 C T 11: 54,933,983 probably benign Het
Trpv5 T C 6: 41,653,231 S642G possibly damaging Het
Ube2d2a T A 18: 35,800,172 D87E possibly damaging Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Vmn2r77 T C 7: 86,803,685 Y537H probably benign Het
Other mutations in Tpgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02303:Tpgs1 APN 10 79675488 missense probably damaging 1.00
IGL02357:Tpgs1 APN 10 79675759 missense probably benign 0.00
IGL02418:Tpgs1 APN 10 79669455 missense probably benign 0.02
IGL02568:Tpgs1 APN 10 79669404 unclassified probably benign
R0220:Tpgs1 UTSW 10 79675437 missense possibly damaging 0.75
R0243:Tpgs1 UTSW 10 79675866 missense probably benign 0.02
R0558:Tpgs1 UTSW 10 79675782 missense probably damaging 0.99
R1507:Tpgs1 UTSW 10 79675786 missense probably damaging 1.00
R1732:Tpgs1 UTSW 10 79675594 missense possibly damaging 0.85
R1800:Tpgs1 UTSW 10 79675510 missense possibly damaging 0.94
R2011:Tpgs1 UTSW 10 79675888 missense probably damaging 1.00
R2973:Tpgs1 UTSW 10 79669615 missense probably damaging 1.00
R4035:Tpgs1 UTSW 10 79669365 unclassified probably null
R4690:Tpgs1 UTSW 10 79675401 missense probably benign 0.00
R4751:Tpgs1 UTSW 10 79675620 missense possibly damaging 0.60
R4995:Tpgs1 UTSW 10 79669491 missense probably benign 0.07
R5682:Tpgs1 UTSW 10 79675587 missense probably damaging 1.00
R5860:Tpgs1 UTSW 10 79669711 missense probably damaging 1.00
R6275:Tpgs1 UTSW 10 79675520 missense probably benign 0.02
R7423:Tpgs1 UTSW 10 79675821 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGAATTATGGCGGCGCTTC -3'
(R):5'- GGAATTGTAGTTCTGGTACCCC -3'

Sequencing Primer
(F):5'- GCTGCCCCCAACAAAGATGG -3'
(R):5'- CATCGGTCCGCACCTCTG -3'
Posted On2014-12-29