Incidental Mutation 'R2974:BC048507'
ID255329
Institutional Source Beutler Lab
Gene Symbol BC048507
Ensembl Gene ENSMUSG00000064063
Gene NamecDNA sequence BC048507
Synonyms
MMRRC Submission 040527-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R2974 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67863326-67863925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67863630 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 42 (I42T)
Ref Sequence ENSEMBL: ENSMUSP00000077564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078471]
Predicted Effect probably benign
Transcript: ENSMUST00000078471
AA Change: I42T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000077564
Gene: ENSMUSG00000064063
AA Change: I42T

DomainStartEndE-ValueType
Dynein_light 1 88 1.05e-56 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,786 D32G probably benign Het
Abca7 T G 10: 80,008,967 F1508V probably damaging Het
Cop1 A G 1: 159,324,929 H583R possibly damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Ctu1 A G 7: 43,675,650 probably benign Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Depdc5 T C 5: 32,934,017 probably null Het
Dnah14 A T 1: 181,755,241 probably null Het
Doxl2 A G 6: 48,976,424 T428A probably benign Het
Dpp10 A G 1: 123,411,705 probably benign Het
Gm13757 A T 2: 88,446,574 C121* probably null Het
Gsdme A G 6: 50,229,324 C180R probably damaging Het
Gse1 C A 8: 120,570,897 probably benign Het
Med15 T C 16: 17,652,711 Y744C probably damaging Het
Nlrp4d A G 7: 10,378,440 probably benign Het
Nyap2 C T 1: 81,191,770 R81* probably null Het
Olfr948 T C 9: 39,318,996 N206S probably damaging Het
Phax T A 18: 56,573,062 M8K probably benign Het
Plec C G 15: 76,188,761 G631R probably damaging Het
Rgs3 A T 4: 62,640,720 T476S probably damaging Het
Rogdi G T 16: 5,011,662 Q90K probably damaging Het
Rxrg G A 1: 167,639,146 R422H probably damaging Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Simc1 A G 13: 54,550,461 D397G probably damaging Het
Slc25a27 T C 17: 43,653,371 N203D probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Tnip1 C T 11: 54,933,983 probably benign Het
Tpgs1 A G 10: 79,669,615 E69G probably damaging Het
Trpv5 T C 6: 41,653,231 S642G possibly damaging Het
Ube2d2a T A 18: 35,800,172 D87E possibly damaging Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Vmn2r77 T C 7: 86,803,685 Y537H probably benign Het
Other mutations in BC048507
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2252:BC048507 UTSW 13 67863507 start codon destroyed probably null 0.97
R2972:BC048507 UTSW 13 67863630 missense probably benign 0.03
R2973:BC048507 UTSW 13 67863630 missense probably benign 0.03
R5463:BC048507 UTSW 13 67863698 missense probably damaging 1.00
R6075:BC048507 UTSW 13 67863704 missense probably benign 0.07
R6798:BC048507 UTSW 13 67863564 missense probably benign 0.29
R7053:BC048507 UTSW 13 67863653 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAGCTAAGAGATGCGCCAC -3'
(R):5'- TTTAGGATGCAGTCAGTCCAC -3'

Sequencing Primer
(F):5'- TTCGGCTTCAGCAGGGAC -3'
(R):5'- CCACGCTTTTACCCAGATTTGAAGAG -3'
Posted On2014-12-29