Incidental Mutation 'R0319:Arhgef19'
ID25533
Institutional Source Beutler Lab
Gene Symbol Arhgef19
Ensembl Gene ENSMUSG00000028919
Gene NameRho guanine nucleotide exchange factor (GEF) 19
Synonyms6430573B13Rik, WGEF
MMRRC Submission 038529-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R0319 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141239499-141257564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141256399 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 748 (T748S)
Ref Sequence ENSEMBL: ENSMUSP00000006618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006618
AA Change: T748S

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006618
Gene: ENSMUSG00000028919
AA Change: T748S

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
RhoGEF 380 559 5.51e-43 SMART
PH 593 706 8.86e-6 SMART
SH3 718 775 5.16e-10 SMART
Meta Mutation Damage Score 0.1153 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide exchange factors (GEFs) such as ARHGEF19 accelerate the GTPase activity of Rho GTPases (see RHOA, MIM 165390).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,237,190 V77G probably benign Het
Abcb1b A G 5: 8,827,428 R663G probably benign Het
Acly A G 11: 100,504,982 V404A probably damaging Het
Actg2 T A 6: 83,520,743 I103F probably damaging Het
Anapc5 A G 5: 122,818,856 V120A probably damaging Het
Ankk1 T G 9: 49,416,071 T603P probably damaging Het
Ankmy2 T C 12: 36,165,899 S33P possibly damaging Het
Atad5 T A 11: 80,120,790 probably benign Het
Atxn10 T C 15: 85,365,282 L105P probably damaging Het
Cacna1s T C 1: 136,070,717 V161A probably damaging Het
Col6a3 T C 1: 90,807,704 E741G possibly damaging Het
Cpne9 G A 6: 113,294,693 G338E probably damaging Het
Cyp3a13 G A 5: 137,898,862 P397S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dirc2 T C 16: 35,750,514 D140G probably benign Het
Draxin A G 4: 148,115,972 L7P probably benign Het
Exosc7 T A 9: 123,130,960 probably benign Het
Far2 A G 6: 148,157,470 E218G probably damaging Het
Ggps1 A C 13: 14,053,877 N240K possibly damaging Het
Kcnip1 T C 11: 33,651,529 probably benign Het
Kcnv2 A T 19: 27,324,024 Y425F probably benign Het
Kdelr2 T A 5: 143,412,517 F40I probably damaging Het
Kdm1b C T 13: 47,053,719 P173L probably benign Het
Kif20b G A 19: 34,947,732 probably benign Het
Klhl9 A T 4: 88,720,454 Y517N possibly damaging Het
Lgals3bp A G 11: 118,393,521 S411P probably damaging Het
Lmo3 G A 6: 138,377,311 T85M probably damaging Het
Lvrn C A 18: 46,864,753 T256N probably damaging Het
Malt1 T C 18: 65,462,915 probably null Het
Mgst1 A G 6: 138,156,157 I157V possibly damaging Het
Mob3a A T 10: 80,689,985 V164E possibly damaging Het
Mprip T A 11: 59,697,038 probably benign Het
Mst1 A G 9: 108,082,513 N276S probably benign Het
Olfr1437 A T 19: 12,322,316 C170* probably null Het
P3h2 T A 16: 25,970,931 I529F possibly damaging Het
Pikfyve T A 1: 65,246,331 S865T probably benign Het
Rcbtb2 G A 14: 73,178,469 R474Q probably benign Het
Rpl27 G A 11: 101,443,495 probably benign Het
Rtp1 G A 16: 23,431,460 E192K probably damaging Het
Sgk2 T C 2: 162,995,672 probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Spdl1 T C 11: 34,823,520 N114S possibly damaging Het
Syne2 C T 12: 76,064,162 R5756W probably damaging Het
Tor1aip1 T C 1: 156,007,181 E307G probably damaging Het
Tpd52 T C 3: 8,953,689 T44A probably benign Het
Trim67 A T 8: 124,823,227 Y532F probably damaging Het
Ttll9 C A 2: 153,000,098 probably null Het
Ush2a T C 1: 188,948,374 probably benign Het
Vcam1 T C 3: 116,116,060 I539M probably benign Het
Vmn1r19 T A 6: 57,404,615 M51K possibly damaging Het
Vmn2r61 T A 7: 42,300,517 M787K probably damaging Het
Xdh T A 17: 73,906,101 probably benign Het
Zfp109 A T 7: 24,234,470 V8E probably damaging Het
Zfp595 G A 13: 67,316,513 A562V possibly damaging Het
Zfp759 A G 13: 67,140,292 T636A probably benign Het
Other mutations in Arhgef19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Arhgef19 APN 4 141248983 unclassified probably benign
IGL02037:Arhgef19 APN 4 141246396 missense probably damaging 0.99
IGL03049:Arhgef19 APN 4 141254316 missense probably damaging 0.98
IGL03071:Arhgef19 APN 4 141249002 missense possibly damaging 0.88
IGL03098:Arhgef19 UTSW 4 141247568 missense possibly damaging 0.85
R0271:Arhgef19 UTSW 4 141250607 missense probably benign 0.00
R1572:Arhgef19 UTSW 4 141254754 missense probably benign 0.10
R1633:Arhgef19 UTSW 4 141238560 unclassified probably benign
R1735:Arhgef19 UTSW 4 141249618 missense possibly damaging 0.55
R1752:Arhgef19 UTSW 4 141251043 missense probably benign 0.27
R1823:Arhgef19 UTSW 4 141249146 missense probably benign 0.01
R1889:Arhgef19 UTSW 4 141249313 missense probably damaging 1.00
R2138:Arhgef19 UTSW 4 141250800 missense probably damaging 1.00
R2280:Arhgef19 UTSW 4 141246516 missense probably benign 0.14
R3430:Arhgef19 UTSW 4 141256800 missense probably benign 0.03
R3954:Arhgef19 UTSW 4 141256334 missense probably damaging 1.00
R4158:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4160:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4995:Arhgef19 UTSW 4 141247515 splice site probably null
R5031:Arhgef19 UTSW 4 141250810 missense probably damaging 0.98
R5782:Arhgef19 UTSW 4 141256312 missense probably damaging 1.00
R5913:Arhgef19 UTSW 4 141249298 missense probably benign 0.03
R7614:Arhgef19 UTSW 4 141256779 missense possibly damaging 0.52
R8356:Arhgef19 UTSW 4 141250615 missense probably benign 0.25
R8456:Arhgef19 UTSW 4 141250615 missense probably benign 0.25
R8531:Arhgef19 UTSW 4 141249592 missense possibly damaging 0.82
R8876:Arhgef19 UTSW 4 141247882 missense probably benign 0.28
R8931:Arhgef19 UTSW 4 141249292 missense probably damaging 0.98
R8947:Arhgef19 UTSW 4 141246307 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCTAGAGGTCAGTTCGAGGTGTCAC -3'
(R):5'- CCACTCTCCATTCTCAAGCAGGAAG -3'

Posted On2013-04-16