Incidental Mutation 'R2975:Tas2r138'
ID255342
Institutional Source Beutler Lab
Gene Symbol Tas2r138
Ensembl Gene ENSMUSG00000058250
Gene Nametaste receptor, type 2, member 138
Synonymsmt2r31, T2R138, Tas2r38
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2975 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location40612315-40613310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40613264 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 16 (I16T)
Ref Sequence ENSEMBL: ENSMUSP00000075876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076565]
Predicted Effect probably benign
Transcript: ENSMUST00000076565
AA Change: I16T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075876
Gene: ENSMUSG00000058250
AA Change: I16T

DomainStartEndE-ValueType
Pfam:TAS2R 11 315 3.8e-64 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G protein-coupled receptor that controls the ability to taste glucosinolates, a family of bitter-tasting compounds found in plants of the Brassica sp. Synthetic compounds phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) have been identified as ligands for this receptor and have been used to test the genetic diversity of this gene. Although several allelic forms of this gene have been identified worldwide, there are two predominant common forms (taster and non-taster) found outside of Africa. These alleles differ at three nucleotide positions resulting in amino acid changes in the protein (A49P, A262V, and V296I) with the amino acid combination PAV identifying the taster variant (and AVI identifying the non-taster variant). [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,957,087 N251D probably damaging Het
Cdca3 A T 6: 124,830,653 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fut8 T C 12: 77,365,013 V83A probably benign Het
Gm38394 T C 1: 133,658,237 Y454C probably damaging Het
Gnb1l T C 16: 18,564,266 S352P probably damaging Het
Hmgxb3 A T 18: 61,162,966 Y323* probably null Het
Katna1 A T 10: 7,743,709 K160N probably benign Het
Kif7 C A 7: 79,710,260 A410S probably damaging Het
Mrpl43 T C 19: 45,006,059 probably null Het
Muc6 T A 7: 141,637,038 E2574V possibly damaging Het
Naip6 A G 13: 100,288,187 V1199A probably damaging Het
Ntn4 A G 10: 93,644,891 Y122C probably damaging Het
Pon3 A G 6: 5,232,345 I225T probably damaging Het
Rrp1b T A 17: 32,058,573 V609E probably damaging Het
Scube1 T C 15: 83,659,098 T180A probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Traf3ip2 A C 10: 39,626,540 Q228P probably benign Het
Vmn2r54 A G 7: 12,635,992 M48T possibly damaging Het
Washc5 T C 15: 59,345,358 N787D probably damaging Het
Other mutations in Tas2r138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Tas2r138 APN 6 40612586 missense probably benign 0.07
IGL01468:Tas2r138 APN 6 40612476 missense probably benign 0.22
IGL02626:Tas2r138 APN 6 40612715 missense possibly damaging 0.61
IGL03008:Tas2r138 APN 6 40613182 missense probably damaging 1.00
R0595:Tas2r138 UTSW 6 40612865 missense probably damaging 1.00
R2845:Tas2r138 UTSW 6 40612767 missense probably benign 0.09
R4202:Tas2r138 UTSW 6 40612476 missense possibly damaging 0.95
R4923:Tas2r138 UTSW 6 40612886 missense possibly damaging 0.82
R5526:Tas2r138 UTSW 6 40612980 missense probably benign 0.00
R6647:Tas2r138 UTSW 6 40612799 missense possibly damaging 0.91
R6869:Tas2r138 UTSW 6 40612421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTTTCATCTGCTGGAAGC -3'
(R):5'- CCTCCAGGTTTCCTATTGGG -3'

Sequencing Primer
(F):5'- CTGGAAGCAGGCGAGCTG -3'
(R):5'- ATTTGGGTTCATAAGGGGAAATTC -3'
Posted On2014-12-29