Incidental Mutation 'R2975:Ntn4'
ID 255350
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Name netrin 4
Synonyms beta-netrin
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2975 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 93476911-93581834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93480753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 122 (Y122C)
Ref Sequence ENSEMBL: ENSMUSP00000123306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204] [ENSMUST00000147080]
AlphaFold Q9JI33
Predicted Effect probably damaging
Transcript: ENSMUST00000020204
AA Change: Y159C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: Y159C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147080
AA Change: Y122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123306
Gene: ENSMUSG00000020019
AA Change: Y122C

DomainStartEndE-ValueType
LamNT 1 143 4.24e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,847,099 (GRCm39) N251D probably damaging Het
Cdca3 A T 6: 124,807,616 (GRCm39) probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fut8 T C 12: 77,411,787 (GRCm39) V83A probably benign Het
Gnb1l T C 16: 18,383,016 (GRCm39) S352P probably damaging Het
Hmgxb3 A T 18: 61,296,038 (GRCm39) Y323* probably null Het
Katna1 A T 10: 7,619,473 (GRCm39) K160N probably benign Het
Kif7 C A 7: 79,360,008 (GRCm39) A410S probably damaging Het
Mrpl43 T C 19: 44,994,498 (GRCm39) probably null Het
Muc6 T A 7: 141,216,951 (GRCm39) E2574V possibly damaging Het
Naip6 A G 13: 100,424,695 (GRCm39) V1199A probably damaging Het
Pon3 A G 6: 5,232,345 (GRCm39) I225T probably damaging Het
Rrp1b T A 17: 32,277,547 (GRCm39) V609E probably damaging Het
Scube1 T C 15: 83,543,299 (GRCm39) T180A probably damaging Het
Tas2r136 C A 6: 132,754,972 (GRCm39) V52L probably damaging Het
Tas2r138 A G 6: 40,590,198 (GRCm39) I16T probably benign Het
Traf3ip2 A C 10: 39,502,536 (GRCm39) Q228P probably benign Het
Vmn2r54 A G 7: 12,369,919 (GRCm39) M48T possibly damaging Het
Washc5 T C 15: 59,217,207 (GRCm39) N787D probably damaging Het
Zbed6 T C 1: 133,585,975 (GRCm39) Y454C probably damaging Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93,543,211 (GRCm39) missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93,480,711 (GRCm39) missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93,480,521 (GRCm39) missense probably benign 0.19
IGL02752:Ntn4 APN 10 93,546,421 (GRCm39) missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93,480,587 (GRCm39) missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93,480,569 (GRCm39) missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93,480,569 (GRCm39) missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93,480,569 (GRCm39) missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93,518,291 (GRCm39) missense probably benign 0.04
R1304:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93,480,596 (GRCm39) missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93,569,464 (GRCm39) splice site probably null
R1796:Ntn4 UTSW 10 93,581,633 (GRCm39) missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93,543,234 (GRCm39) missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93,543,234 (GRCm39) missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93,480,701 (GRCm39) missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R4277:Ntn4 UTSW 10 93,577,072 (GRCm39) missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93,480,362 (GRCm39) missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93,480,362 (GRCm39) missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93,480,362 (GRCm39) missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93,480,626 (GRCm39) missense probably benign 0.40
R6048:Ntn4 UTSW 10 93,543,128 (GRCm39) splice site probably null
R6051:Ntn4 UTSW 10 93,581,657 (GRCm39) missense probably benign
R6346:Ntn4 UTSW 10 93,480,723 (GRCm39) missense probably damaging 1.00
R6752:Ntn4 UTSW 10 93,570,037 (GRCm39) missense probably benign
R7196:Ntn4 UTSW 10 93,569,576 (GRCm39) missense probably benign 0.01
R7240:Ntn4 UTSW 10 93,581,603 (GRCm39) missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93,480,666 (GRCm39) missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93,518,434 (GRCm39) missense probably benign
R7505:Ntn4 UTSW 10 93,543,146 (GRCm39) missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93,546,430 (GRCm39) missense probably benign 0.01
R7726:Ntn4 UTSW 10 93,569,544 (GRCm39) missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93,480,335 (GRCm39) splice site probably benign
R8092:Ntn4 UTSW 10 93,576,918 (GRCm39) missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93,480,765 (GRCm39) missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93,576,966 (GRCm39) missense possibly damaging 0.48
R9008:Ntn4 UTSW 10 93,569,466 (GRCm39) splice site probably benign
R9010:Ntn4 UTSW 10 93,480,506 (GRCm39) missense
R9115:Ntn4 UTSW 10 93,569,675 (GRCm39) missense probably benign
R9415:Ntn4 UTSW 10 93,480,488 (GRCm39) missense probably benign 0.00
RF045:Ntn4 UTSW 10 93,546,487 (GRCm39) missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93,480,833 (GRCm39) missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93,577,015 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCAGACTCATCCTTCAG -3'
(R):5'- TGACTGAAATCCAGCCAGTG -3'

Sequencing Primer
(F):5'- TTCAGGTTTCCCCGGACATGG -3'
(R):5'- GTGCAAATAGCTCCCTTC -3'
Posted On 2014-12-29