Incidental Mutation 'R2918:Olfr24'
ID255376
Institutional Source Beutler Lab
Gene Symbol Olfr24
Ensembl Gene ENSMUSG00000054141
Gene Nameolfactory receptor 24
SynonymsMOR132-1, GA_x6K02T2PVTD-12498544-12497603, MTPCR51
MMRRC Submission 040503-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2918 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18751507-18763996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18755479 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 52 (D52V)
Ref Sequence ENSEMBL: ENSMUSP00000149702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066997] [ENSMUST00000216754]
Predicted Effect probably damaging
Transcript: ENSMUST00000066997
AA Change: D52V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064189
Gene: ENSMUSG00000054141
AA Change: D52V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-64 PFAM
Pfam:7TM_GPCR_Srsx 35 304 9.2e-9 PFAM
Pfam:7tm_1 41 290 3.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212239
AA Change: D52V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214366
Predicted Effect probably damaging
Transcript: ENSMUST00000216754
AA Change: D52V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd5 A G 2: 23,099,567 N401D probably benign Het
Agtpbp1 T A 13: 59,497,015 D679V possibly damaging Het
Akap8 A G 17: 32,305,648 V558A probably benign Het
Armc4 G A 18: 7,222,625 S548L probably benign Het
Arrdc2 C T 8: 70,837,527 R170Q probably benign Het
Atg10 A T 13: 91,040,908 H94Q probably damaging Het
Atg4a-ps G A 3: 103,645,521 A168V probably damaging Het
Crb2 G T 2: 37,783,383 R97L probably benign Het
Dnaja1 C T 4: 40,724,052 A71V possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
G6pd2 A G 5: 61,809,526 R215G probably damaging Het
Hcn3 A G 3: 89,147,613 S776P probably benign Het
Ift140 C A 17: 25,035,831 N159K possibly damaging Het
Mafa A G 15: 75,747,298 S209P probably benign Het
Mug2 A G 6: 122,074,724 probably null Het
Myh14 T C 7: 44,616,263 D1564G possibly damaging Het
Ncor2 T A 5: 125,025,760 I1792F probably damaging Het
Nod2 T C 8: 88,652,891 F7L probably benign Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Olfr975 A G 9: 39,950,364 S136P probably benign Het
Pak3 T C X: 143,764,976 V318A probably damaging Het
Pik3ap1 T C 19: 41,302,531 T521A probably benign Het
Pkdcc G C 17: 83,215,949 A162P probably benign Het
Rassf4 A G 6: 116,641,740 V194A probably damaging Het
Scp2d1 T A 2: 144,823,948 I69N probably damaging Het
Spg11 A G 2: 122,075,301 S1288P probably damaging Het
Sptb A G 12: 76,598,758 S2019P probably damaging Het
Stxbp5l A T 16: 37,200,642 L630* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Trpc1 C T 9: 95,723,129 R159H probably damaging Het
Zbtb14 C T 17: 69,388,219 P304L probably damaging Het
Other mutations in Olfr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02346:Olfr24 APN 9 18754769 missense probably damaging 0.97
IGL02371:Olfr24 APN 9 18754704 missense probably benign 0.07
IGL02555:Olfr24 APN 9 18755473 missense probably benign 0.40
IGL03025:Olfr24 APN 9 18755369 missense probably benign 0.00
IGL03259:Olfr24 APN 9 18755515 missense probably benign
IGL03050:Olfr24 UTSW 9 18755454 nonsense probably null
R0310:Olfr24 UTSW 9 18755333 missense possibly damaging 0.91
R0410:Olfr24 UTSW 9 18754841 missense probably damaging 0.96
R2152:Olfr24 UTSW 9 18755095 missense probably damaging 1.00
R2153:Olfr24 UTSW 9 18755095 missense probably damaging 1.00
R4552:Olfr24 UTSW 9 18755134 missense possibly damaging 0.60
R5073:Olfr24 UTSW 9 18754822 missense possibly damaging 0.89
R5539:Olfr24 UTSW 9 18754838 missense probably damaging 0.99
R5662:Olfr24 UTSW 9 18755600 missense probably damaging 0.99
R6145:Olfr24 UTSW 9 18755569 missense probably benign 0.06
R7125:Olfr24 UTSW 9 18754878 nonsense probably null
R7196:Olfr24 UTSW 9 18755590 nonsense probably null
R7607:Olfr24 UTSW 9 18754882 missense possibly damaging 0.93
Z1177:Olfr24 UTSW 9 18755519 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AAGACACTGTCCATGATGCC -3'
(R):5'- ATTAGCTCAGACAAGAACTGGATAG -3'

Sequencing Primer
(F):5'- GTACATCTGGGTCAGACAA -3'
(R):5'- AGTTAATTTGTTTTACCCTCACAACC -3'
Posted On2014-12-29