Incidental Mutation 'R0318:Blk'
ID25538
Institutional Source Beutler Lab
Gene Symbol Blk
Ensembl Gene ENSMUSG00000014453
Gene NameB lymphoid kinase
Synonyms
MMRRC Submission 038528-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0318 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63372836-63417037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63374197 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 430 (Y430H)
Ref Sequence ENSEMBL: ENSMUSP00000014597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014597]
PDB Structure
NMR ENSEMBLE OF BLK SH2 DOMAIN, 20 STRUCTURES [SOLUTION NMR]
NMR ENSEMBLE OF BLK SH2 DOMAIN USING CHEMICAL SHIFT REFINEMENT, 20 STRUCTURES [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000014597
AA Change: Y430H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014597
Gene: ENSMUSG00000014453
AA Change: Y430H

DomainStartEndE-ValueType
SH3 55 111 2.91e-18 SMART
SH2 116 205 1.32e-32 SMART
TyrKc 235 484 1.97e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224965
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nonreceptor tyrosine-kinase of the src family of proto-oncogenes that are typically involved in cell proliferation and differentiation. The protein has a role in B-cell receptor signaling and B-cell development. The protein also stimulates insulin synthesis and secretion in response to glucose and enhances the expression of several pancreatic beta-cell transcription factors. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,974 L79Q probably damaging Het
Add1 T C 5: 34,625,340 V130A probably damaging Het
Ankrd23 G T 1: 36,534,072 T73K probably benign Het
BC005561 T C 5: 104,517,753 F47S probably benign Het
C3 C T 17: 57,224,709 V272M probably damaging Het
Cerk C T 15: 86,151,565 A254T possibly damaging Het
Ces2a G A 8: 104,740,824 A494T probably damaging Het
Cfap46 T C 7: 139,654,566 Y258C probably damaging Het
Chaf1a C T 17: 56,062,227 T486I possibly damaging Het
Colec12 A G 18: 9,848,446 N208S possibly damaging Het
Coro7 T A 16: 4,675,807 H63L probably benign Het
Cps1 T A 1: 67,177,014 W833R probably damaging Het
Csmd3 A T 15: 47,659,153 W2707R probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Ddx50 A T 10: 62,642,837 I190K probably damaging Het
Dnmt3l G A 10: 78,055,055 V264M probably damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam163a A G 1: 156,079,969 C26R probably damaging Het
Fam83h A G 15: 76,003,629 S620P probably benign Het
Fcna A G 2: 25,625,059 S263P probably benign Het
Fnip2 A T 3: 79,512,378 S165R probably damaging Het
Fpr-rs3 T C 17: 20,624,148 T244A probably benign Het
Gpr152 T C 19: 4,143,542 S361P possibly damaging Het
Grm5 A T 7: 87,602,967 I142L probably damaging Het
Gucy2g A G 19: 55,237,798 S229P probably benign Het
Htr7 C T 19: 35,969,486 G376D probably damaging Het
Irgc1 T C 7: 24,432,471 D307G probably benign Het
Irs1 A T 1: 82,288,660 S612T probably benign Het
Maml2 C T 9: 13,620,594 T368I probably damaging Het
Mapkapk2 A G 1: 131,097,335 V64A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nptx1 C T 11: 119,542,541 E411K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr995 C A 2: 85,438,237 R307M possibly damaging Het
Pcgf5 A T 19: 36,412,190 K22N possibly damaging Het
Psmd9 C A 5: 123,234,649 A65E possibly damaging Het
Sh3bp1 A G 15: 78,911,707 T679A probably damaging Het
Sipa1l2 G A 8: 125,447,697 P1281S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a24 A G 3: 109,157,000 M222V probably benign Het
Smg9 T C 7: 24,420,888 F429S possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorl1 T A 9: 42,081,954 Y258F probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Stc1 A T 14: 69,038,418 Q220L probably damaging Het
Tas2r122 T C 6: 132,711,832 T33A possibly damaging Het
Tbc1d10b A G 7: 127,199,034 L645P probably damaging Het
Timd4 T A 11: 46,837,071 H272Q probably benign Het
Ttll5 T G 12: 85,876,594 probably null Het
Veph1 G T 3: 66,057,259 S783Y probably damaging Het
Vmn1r230 T C 17: 20,846,816 L89S possibly damaging Het
Xcr1 A G 9: 123,856,154 V165A possibly damaging Het
Zfp286 T C 11: 62,784,962 D58G probably damaging Het
Zfyve26 C T 12: 79,276,281 R897H probably damaging Het
Other mutations in Blk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Blk APN 14 63380720 missense probably damaging 1.00
IGL02146:Blk APN 14 63374199 missense probably damaging 1.00
IGL02684:Blk APN 14 63379694 missense probably benign 0.17
blaenka UTSW 14 63384002 missense probably damaging 1.00
R0254:Blk UTSW 14 63380804 missense probably benign 0.08
R1567:Blk UTSW 14 63380729 missense probably damaging 0.99
R1871:Blk UTSW 14 63375915 missense possibly damaging 0.72
R3719:Blk UTSW 14 63384002 missense probably damaging 1.00
R4606:Blk UTSW 14 63374203 missense probably benign 0.00
R4879:Blk UTSW 14 63375965 missense probably benign
R4935:Blk UTSW 14 63381262 missense possibly damaging 0.95
R5014:Blk UTSW 14 63379787 missense probably benign 0.00
R5352:Blk UTSW 14 63375971 missense probably damaging 1.00
R5406:Blk UTSW 14 63380731 missense probably damaging 1.00
R5514:Blk UTSW 14 63378481 missense probably damaging 0.99
R5518:Blk UTSW 14 63378507 missense possibly damaging 0.56
R6289:Blk UTSW 14 63375892 splice site probably null
R6743:Blk UTSW 14 63384926 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTGGAAGGTCACATAGGTGC -3'
(R):5'- TTGGCTGTCCCTGGAGCTACTG -3'

Sequencing Primer
(F):5'- tccctctccctctccctc -3'
(R):5'- GGAGCTACTGCACTTTCCTGG -3'
Posted On2013-04-16