Incidental Mutation 'R2918:Atg10'
ID255383
Institutional Source Beutler Lab
Gene Symbol Atg10
Ensembl Gene ENSMUSG00000021619
Gene Nameautophagy related 10
Synonyms5330424L23Rik, 5430428K15Rik, APG10, Apg10l, Apg10p
MMRRC Submission 040503-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2918 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location90935356-91223968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91040908 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 94 (H94Q)
Ref Sequence ENSEMBL: ENSMUSP00000022119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022119] [ENSMUST00000224449]
Predicted Effect probably damaging
Transcript: ENSMUST00000022119
AA Change: H94Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022119
Gene: ENSMUSG00000021619
AA Change: H94Q

DomainStartEndE-ValueType
Pfam:Autophagy_act_C 95 162 9.1e-19 PFAM
low complexity region 188 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223729
Predicted Effect probably benign
Transcript: ENSMUST00000224449
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes. ATG10 is an E2-like enzyme involved in 2 ubiquitin-like modifications essential for autophagosome formation: ATG12 (MIM 609608)-ATG5 (MIM 604261) conjugation and modification of a soluble form of MAP-LC3 (MAP1LC3A; MIM 601242), a homolog of yeast Apg8, to a membrane-bound form (Nemoto et al., 2003 [PubMed 12890687]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd5 A G 2: 23,099,567 N401D probably benign Het
Agtpbp1 T A 13: 59,497,015 D679V possibly damaging Het
Akap8 A G 17: 32,305,648 V558A probably benign Het
Armc4 G A 18: 7,222,625 S548L probably benign Het
Arrdc2 C T 8: 70,837,527 R170Q probably benign Het
Atg4a-ps G A 3: 103,645,521 A168V probably damaging Het
Crb2 G T 2: 37,783,383 R97L probably benign Het
Dnaja1 C T 4: 40,724,052 A71V possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
G6pd2 A G 5: 61,809,526 R215G probably damaging Het
Hcn3 A G 3: 89,147,613 S776P probably benign Het
Ift140 C A 17: 25,035,831 N159K possibly damaging Het
Mafa A G 15: 75,747,298 S209P probably benign Het
Mug2 A G 6: 122,074,724 probably null Het
Myh14 T C 7: 44,616,263 D1564G possibly damaging Het
Ncor2 T A 5: 125,025,760 I1792F probably damaging Het
Nod2 T C 8: 88,652,891 F7L probably benign Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Olfr24 T A 9: 18,755,479 D52V probably damaging Het
Olfr975 A G 9: 39,950,364 S136P probably benign Het
Pak3 T C X: 143,764,976 V318A probably damaging Het
Pik3ap1 T C 19: 41,302,531 T521A probably benign Het
Pkdcc G C 17: 83,215,949 A162P probably benign Het
Rassf4 A G 6: 116,641,740 V194A probably damaging Het
Scp2d1 T A 2: 144,823,948 I69N probably damaging Het
Spg11 A G 2: 122,075,301 S1288P probably damaging Het
Sptb A G 12: 76,598,758 S2019P probably damaging Het
Stxbp5l A T 16: 37,200,642 L630* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Trpc1 C T 9: 95,723,129 R159H probably damaging Het
Zbtb14 C T 17: 69,388,219 P304L probably damaging Het
Other mutations in Atg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Atg10 APN 13 91154211 splice site probably benign
IGL03131:Atg10 APN 13 90937293 missense probably null 0.99
R0362:Atg10 UTSW 13 91040990 critical splice acceptor site probably null
R0826:Atg10 UTSW 13 90936586 critical splice donor site probably null
R1593:Atg10 UTSW 13 91154261 missense probably benign 0.02
R3012:Atg10 UTSW 13 91154278 missense probably damaging 0.99
R3036:Atg10 UTSW 13 91040898 missense probably damaging 1.00
R3837:Atg10 UTSW 13 90937380 missense probably damaging 1.00
R3838:Atg10 UTSW 13 90937380 missense probably damaging 1.00
R3839:Atg10 UTSW 13 90937380 missense probably damaging 1.00
R4324:Atg10 UTSW 13 91040966 missense probably damaging 1.00
R6195:Atg10 UTSW 13 91208436 splice site probably null
R6478:Atg10 UTSW 13 90937347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAAACCTTACCTCAACTAC -3'
(R):5'- GTCATTTGCAAGGAGAAGCTCTC -3'

Sequencing Primer
(F):5'- TCTTCCCCTCTCAGGAATG -3'
(R):5'- AGAAGCTCTCACCCTTCTCTTTC -3'
Posted On2014-12-29