Incidental Mutation 'R2918:Akap8'
ID255389
Institutional Source Beutler Lab
Gene Symbol Akap8
Ensembl Gene ENSMUSG00000024045
Gene NameA kinase (PRKA) anchor protein 8
Synonyms1200016A02Rik, AKAP95
MMRRC Submission 040503-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2918 (G1)
Quality Score224
Status Not validated
Chromosome17
Chromosomal Location32303676-32321153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32305648 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 558 (V558A)
Ref Sequence ENSEMBL: ENSMUSP00000002699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002699]
Predicted Effect probably benign
Transcript: ENSMUST00000002699
AA Change: V558A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000002699
Gene: ENSMUSG00000024045
AA Change: V558A

DomainStartEndE-ValueType
SCOP:d1a0tp_ 12 108 3e-19 SMART
low complexity region 183 198 N/A INTRINSIC
low complexity region 257 270 N/A INTRINSIC
low complexity region 354 384 N/A INTRINSIC
ZnF_C2H2 387 411 9.46e0 SMART
Blast:ZnF_C2H2 476 501 9e-9 BLAST
low complexity region 551 582 N/A INTRINSIC
low complexity region 642 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the A-kinase anchoring protein (AKAP) family. These proteins are characterized by their ability to bind to the R subunit of protein kinase A (PKA) and anchor the protein at different subcellular locations. This protein has been shown to regulate apoptosis and to be involved in palatogenesis. Knockdown of this gene has been associated with altered histone modifications and reduced expression of developmental genes in mouse embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a gene trap insertion are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd5 A G 2: 23,099,567 N401D probably benign Het
Agtpbp1 T A 13: 59,497,015 D679V possibly damaging Het
Armc4 G A 18: 7,222,625 S548L probably benign Het
Arrdc2 C T 8: 70,837,527 R170Q probably benign Het
Atg10 A T 13: 91,040,908 H94Q probably damaging Het
Atg4a-ps G A 3: 103,645,521 A168V probably damaging Het
Crb2 G T 2: 37,783,383 R97L probably benign Het
Dnaja1 C T 4: 40,724,052 A71V possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
G6pd2 A G 5: 61,809,526 R215G probably damaging Het
Hcn3 A G 3: 89,147,613 S776P probably benign Het
Ift140 C A 17: 25,035,831 N159K possibly damaging Het
Mafa A G 15: 75,747,298 S209P probably benign Het
Mug2 A G 6: 122,074,724 probably null Het
Myh14 T C 7: 44,616,263 D1564G possibly damaging Het
Ncor2 T A 5: 125,025,760 I1792F probably damaging Het
Nod2 T C 8: 88,652,891 F7L probably benign Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Olfr24 T A 9: 18,755,479 D52V probably damaging Het
Olfr975 A G 9: 39,950,364 S136P probably benign Het
Pak3 T C X: 143,764,976 V318A probably damaging Het
Pik3ap1 T C 19: 41,302,531 T521A probably benign Het
Pkdcc G C 17: 83,215,949 A162P probably benign Het
Rassf4 A G 6: 116,641,740 V194A probably damaging Het
Scp2d1 T A 2: 144,823,948 I69N probably damaging Het
Spg11 A G 2: 122,075,301 S1288P probably damaging Het
Sptb A G 12: 76,598,758 S2019P probably damaging Het
Stxbp5l A T 16: 37,200,642 L630* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Trpc1 C T 9: 95,723,129 R159H probably damaging Het
Zbtb14 C T 17: 69,388,219 P304L probably damaging Het
Other mutations in Akap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Akap8 APN 17 32317280 missense probably damaging 1.00
IGL01450:Akap8 APN 17 32315687 missense probably damaging 1.00
IGL02002:Akap8 APN 17 32309496 missense probably damaging 1.00
IGL02223:Akap8 APN 17 32316647 missense probably damaging 1.00
IGL02315:Akap8 APN 17 32305501 missense probably benign 0.01
IGL03404:Akap8 APN 17 32312276 splice site probably benign
R0310:Akap8 UTSW 17 32316260 missense possibly damaging 0.81
R0526:Akap8 UTSW 17 32317292 missense probably benign 0.28
R1795:Akap8 UTSW 17 32315477 missense probably damaging 1.00
R1992:Akap8 UTSW 17 32316612 missense probably damaging 0.99
R2571:Akap8 UTSW 17 32315455 missense probably damaging 1.00
R3423:Akap8 UTSW 17 32316455 missense possibly damaging 0.61
R3870:Akap8 UTSW 17 32317839 unclassified probably benign
R4077:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4078:Akap8 UTSW 17 32312298 missense probably damaging 1.00
R4379:Akap8 UTSW 17 32306560 missense probably damaging 0.99
R4756:Akap8 UTSW 17 32316210 missense probably damaging 0.98
R4819:Akap8 UTSW 17 32312305 missense probably damaging 1.00
R5091:Akap8 UTSW 17 32316234 missense probably benign 0.05
R5761:Akap8 UTSW 17 32317185 missense possibly damaging 0.56
R6896:Akap8 UTSW 17 32317331 missense probably benign 0.00
R7138:Akap8 UTSW 17 32316541 missense possibly damaging 0.86
R7350:Akap8 UTSW 17 32316575 missense possibly damaging 0.92
X0020:Akap8 UTSW 17 32315750 missense probably benign 0.08
Z1176:Akap8 UTSW 17 32306549 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCCTGGTTTCAGATGCTG -3'
(R):5'- AGGCTGCAGTCTACAGTGTAG -3'

Sequencing Primer
(F):5'- CTGGTTTCAGATGCTGCTTCACAG -3'
(R):5'- CTGCAGTCTACAGTGTAGTGTGC -3'
Posted On2014-12-29