Incidental Mutation 'R2918:Pik3ap1'
ID255394
Institutional Source Beutler Lab
Gene Symbol Pik3ap1
Ensembl Gene ENSMUSG00000025017
Gene Namephosphoinositide-3-kinase adaptor protein 1
SynonymsBCAP, 1810044J04Rik
MMRRC Submission 040503-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2918 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41274218-41385070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41302531 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 521 (T521A)
Ref Sequence ENSEMBL: ENSMUSP00000052777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059672]
Predicted Effect probably benign
Transcript: ENSMUST00000059672
AA Change: T521A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052777
Gene: ENSMUSG00000025017
AA Change: T521A

DomainStartEndE-ValueType
DBB 180 319 8.55e-75 SMART
SCOP:d1bd8__ 331 396 8e-5 SMART
Blast:ANK 336 365 1e-7 BLAST
low complexity region 533 552 N/A INTRINSIC
low complexity region 716 740 N/A INTRINSIC
low complexity region 802 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in B cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd5 A G 2: 23,099,567 N401D probably benign Het
Agtpbp1 T A 13: 59,497,015 D679V possibly damaging Het
Akap8 A G 17: 32,305,648 V558A probably benign Het
Armc4 G A 18: 7,222,625 S548L probably benign Het
Arrdc2 C T 8: 70,837,527 R170Q probably benign Het
Atg10 A T 13: 91,040,908 H94Q probably damaging Het
Atg4a-ps G A 3: 103,645,521 A168V probably damaging Het
Crb2 G T 2: 37,783,383 R97L probably benign Het
Dnaja1 C T 4: 40,724,052 A71V possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
G6pd2 A G 5: 61,809,526 R215G probably damaging Het
Hcn3 A G 3: 89,147,613 S776P probably benign Het
Ift140 C A 17: 25,035,831 N159K possibly damaging Het
Mafa A G 15: 75,747,298 S209P probably benign Het
Mug2 A G 6: 122,074,724 probably null Het
Myh14 T C 7: 44,616,263 D1564G possibly damaging Het
Ncor2 T A 5: 125,025,760 I1792F probably damaging Het
Nod2 T C 8: 88,652,891 F7L probably benign Het
Olfr223 T C 11: 59,589,439 T217A probably benign Het
Olfr24 T A 9: 18,755,479 D52V probably damaging Het
Olfr975 A G 9: 39,950,364 S136P probably benign Het
Pak3 T C X: 143,764,976 V318A probably damaging Het
Pkdcc G C 17: 83,215,949 A162P probably benign Het
Rassf4 A G 6: 116,641,740 V194A probably damaging Het
Scp2d1 T A 2: 144,823,948 I69N probably damaging Het
Spg11 A G 2: 122,075,301 S1288P probably damaging Het
Sptb A G 12: 76,598,758 S2019P probably damaging Het
Stxbp5l A T 16: 37,200,642 L630* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Trpc1 C T 9: 95,723,129 R159H probably damaging Het
Zbtb14 C T 17: 69,388,219 P304L probably damaging Het
Other mutations in Pik3ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Pik3ap1 APN 19 41375890 missense possibly damaging 0.95
IGL01697:Pik3ap1 APN 19 41324579 missense probably damaging 1.00
IGL01743:Pik3ap1 APN 19 41292828 splice site probably benign
IGL02006:Pik3ap1 APN 19 41302593 missense probably benign
IGL02507:Pik3ap1 APN 19 41282012 splice site probably benign
IGL02601:Pik3ap1 APN 19 41302442 missense probably benign 0.08
Canvasback UTSW 19 41321630 missense possibly damaging 0.80
Pintail UTSW 19 41376146 missense probably benign 0.00
sooni UTSW 19 41327909 missense probably damaging 1.00
sothe UTSW 19 41356683 intron probably benign
FR4449:Pik3ap1 UTSW 19 41281946 small insertion probably benign
FR4548:Pik3ap1 UTSW 19 41281945 small insertion probably benign
FR4976:Pik3ap1 UTSW 19 41281945 small insertion probably benign
R0504:Pik3ap1 UTSW 19 41287490 missense probably damaging 1.00
R0505:Pik3ap1 UTSW 19 41324564 missense probably damaging 1.00
R0736:Pik3ap1 UTSW 19 41332319 missense possibly damaging 0.56
R0926:Pik3ap1 UTSW 19 41302525 missense probably benign 0.00
R1521:Pik3ap1 UTSW 19 41321558 missense probably damaging 1.00
R1681:Pik3ap1 UTSW 19 41308529 missense probably damaging 1.00
R1779:Pik3ap1 UTSW 19 41332234 missense probably damaging 1.00
R1924:Pik3ap1 UTSW 19 41302614 missense possibly damaging 0.79
R1945:Pik3ap1 UTSW 19 41274337 missense probably benign
R2327:Pik3ap1 UTSW 19 41296389 missense probably damaging 0.99
R2891:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2892:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2893:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2894:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R4424:Pik3ap1 UTSW 19 41375881 missense probably benign 0.00
R4654:Pik3ap1 UTSW 19 41327909 missense probably damaging 1.00
R4811:Pik3ap1 UTSW 19 41302497 missense possibly damaging 0.67
R4855:Pik3ap1 UTSW 19 41327845 missense probably benign 0.13
R4885:Pik3ap1 UTSW 19 41375926 missense probably benign 0.28
R5119:Pik3ap1 UTSW 19 41281976 missense probably benign 0.18
R5261:Pik3ap1 UTSW 19 41376106 missense probably damaging 1.00
R5274:Pik3ap1 UTSW 19 41281952 missense possibly damaging 0.67
R5655:Pik3ap1 UTSW 19 41298241 missense possibly damaging 0.65
R5862:Pik3ap1 UTSW 19 41332345 missense probably damaging 1.00
R5924:Pik3ap1 UTSW 19 41296456 missense probably damaging 1.00
R6015:Pik3ap1 UTSW 19 41328201 missense probably benign 0.22
R6018:Pik3ap1 UTSW 19 41385016 start gained probably benign
R6515:Pik3ap1 UTSW 19 41376146 missense probably benign 0.00
R6792:Pik3ap1 UTSW 19 41321626 missense probably benign 0.14
R7135:Pik3ap1 UTSW 19 41332321 missense probably damaging 1.00
R7162:Pik3ap1 UTSW 19 41321526 missense probably benign 0.03
R7175:Pik3ap1 UTSW 19 41287490 missense probably damaging 0.98
R7313:Pik3ap1 UTSW 19 41296376 missense possibly damaging 0.93
R7664:Pik3ap1 UTSW 19 41321630 missense possibly damaging 0.80
R7786:Pik3ap1 UTSW 19 41321585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGGCAACCATCCAAAAG -3'
(R):5'- AACATTCGCTCGGTCTTACC -3'

Sequencing Primer
(F):5'- GATGTTCCTGCTGAGGCTCTC -3'
(R):5'- CACCTTCAGGCAGGCAATTTC -3'
Posted On2014-12-29