Incidental Mutation 'R2919:Stradb'
ID255396
Institutional Source Beutler Lab
Gene Symbol Stradb
Ensembl Gene ENSMUSG00000026027
Gene NameSTE20-related kinase adaptor beta
SynonymsAls2cr2, D1Ucla2, PRO1038
MMRRC Submission 040504-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2919 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58973522-58995715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58992669 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 247 (V247M)
Ref Sequence ENSEMBL: ENSMUSP00000027185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027185] [ENSMUST00000114296] [ENSMUST00000123301] [ENSMUST00000153990]
Predicted Effect probably benign
Transcript: ENSMUST00000027185
AA Change: V247M

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027185
Gene: ENSMUSG00000026027
AA Change: V247M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 58 290 3.2e-26 PFAM
Pfam:Pkinase 58 369 7.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054653
Predicted Effect probably benign
Transcript: ENSMUST00000114296
SMART Domains Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 185 1.1e-16 PFAM
Pfam:Pkinase_Tyr 58 188 1.3e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000123301
AA Change: M189I
SMART Domains Protein: ENSMUSP00000138036
Gene: ENSMUSG00000026027
AA Change: M189I

DomainStartEndE-ValueType
Pfam:Pkinase 58 184 2.7e-17 PFAM
Pfam:Pkinase_Tyr 58 185 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147637
Predicted Effect unknown
Transcript: ENSMUST00000152318
AA Change: V90M
Predicted Effect probably benign
Transcript: ENSMUST00000153990
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik C T 5: 146,185,191 R27H probably benign Het
2310002L09Rik A T 4: 73,950,608 L31Q probably damaging Het
Agbl1 G A 7: 76,414,658 D53N probably damaging Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Als2cl A T 9: 110,897,499 probably null Het
Atg9b T A 5: 24,391,544 T125S possibly damaging Het
Casp8ap2 A G 4: 32,645,343 D1472G probably damaging Het
Cd1d2 C G 3: 86,987,680 P158A probably damaging Het
Cdc45 A G 16: 18,808,793 I94T probably benign Het
Chd6 T G 2: 160,967,880 D1487A possibly damaging Het
Edem2 T C 2: 155,709,027 Y340C probably damaging Het
Fbxl12 C T 9: 20,642,213 R26H probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Gm5884 A G 6: 128,645,058 noncoding transcript Het
Inpp4b C A 8: 81,985,329 A425E possibly damaging Het
Kif1a A G 1: 93,046,742 Y964H probably damaging Het
Lrp1b A C 2: 41,770,899 C66G probably damaging Het
Lrp4 A G 2: 91,490,730 I1034V probably benign Het
Mmrn2 T C 14: 34,402,922 V820A possibly damaging Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mroh9 A C 1: 163,056,772 M399R probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp2 G A 5: 65,807,098 G830D probably benign Het
Nagpa G A 16: 5,203,787 probably benign Het
Olfr1000 G A 2: 85,608,410 P167S probably benign Het
Olfr690 C T 7: 105,329,860 V111M probably damaging Het
Oxgr1 T A 14: 120,022,809 probably benign Het
Parp3 T A 9: 106,473,725 R323W possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Pfkp C T 13: 6,593,243 G513D probably damaging Het
Pla2g4d T C 2: 120,281,627 probably benign Het
Rtl1 T C 12: 109,591,148 E1419G unknown Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Sgk2 T G 2: 162,999,195 L175R probably damaging Het
Sgk2 C A 2: 162,999,205 F178L probably damaging Het
Sim1 T C 10: 50,909,815 Y255H probably benign Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc38a3 A T 9: 107,657,687 I163N probably damaging Het
Slc39a4 A G 15: 76,616,670 L31P probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Slfnl1 G T 4: 120,533,078 probably benign Het
Styk1 T A 6: 131,313,004 probably benign Het
Sult1d1 A G 5: 87,559,755 probably benign Het
Syk C T 13: 52,611,121 P95S probably benign Het
Taar2 T A 10: 23,941,556 N331K probably benign Het
Thsd7b A G 1: 130,189,850 probably benign Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tmbim7 G A 5: 3,673,188 probably null Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Tmem184c A T 8: 77,604,647 C158S probably damaging Het
Tmpo A G 10: 91,152,686 I310T probably benign Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Xirp1 T C 9: 120,018,701 E372G possibly damaging Het
Zbtb5 T C 4: 44,994,790 E198G probably damaging Het
Zfp804a A G 2: 82,235,816 N44D probably damaging Het
Other mutations in Stradb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Stradb APN 1 58988529 missense probably damaging 0.98
IGL00843:Stradb APN 1 58994409 missense probably benign
IGL01288:Stradb APN 1 58992301 missense possibly damaging 0.61
IGL02045:Stradb APN 1 58989778 missense probably damaging 1.00
IGL02818:Stradb APN 1 58979962 missense probably damaging 0.99
P0047:Stradb UTSW 1 58989798 missense probably null 0.86
R0739:Stradb UTSW 1 58977015 unclassified probably benign
R0970:Stradb UTSW 1 58977060 missense possibly damaging 0.92
R1809:Stradb UTSW 1 58994390 missense possibly damaging 0.54
R1930:Stradb UTSW 1 58991105 missense probably benign 0.07
R1931:Stradb UTSW 1 58991105 missense probably benign 0.07
R1932:Stradb UTSW 1 58991105 missense probably benign 0.07
R2570:Stradb UTSW 1 58988584 missense probably damaging 1.00
R3104:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3105:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3106:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3772:Stradb UTSW 1 58985385 missense probably benign 0.04
R4120:Stradb UTSW 1 58980009 missense possibly damaging 0.92
R4417:Stradb UTSW 1 58994372 missense probably benign
R4569:Stradb UTSW 1 58979958 nonsense probably null
R4601:Stradb UTSW 1 58993572 missense probably damaging 0.98
R4758:Stradb UTSW 1 58988571 missense probably benign 0.02
R4786:Stradb UTSW 1 58991208 intron probably benign
R4944:Stradb UTSW 1 58980440 missense probably benign 0.27
R5113:Stradb UTSW 1 58991174 intron probably benign
R5568:Stradb UTSW 1 58992742 missense possibly damaging 0.72
R5765:Stradb UTSW 1 58992744 missense probably benign 0.31
R5970:Stradb UTSW 1 58980016 critical splice donor site probably null
R6234:Stradb UTSW 1 58988548 missense probably damaging 1.00
R7411:Stradb UTSW 1 58988518 missense possibly damaging 0.95
R7511:Stradb UTSW 1 58992949 missense probably damaging 0.97
R7569:Stradb UTSW 1 58991151 missense unknown
R7575:Stradb UTSW 1 58988580 missense probably benign 0.00
R7646:Stradb UTSW 1 58994408 missense probably benign 0.14
R7658:Stradb UTSW 1 58992726 missense probably damaging 0.96
R8306:Stradb UTSW 1 58991197 missense unknown
R8812:Stradb UTSW 1 58994319 missense probably benign 0.16
Z1176:Stradb UTSW 1 58992999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTCACACGTGTGTTAGG -3'
(R):5'- ACGGAGGACCTTTCAGTTTC -3'

Sequencing Primer
(F):5'- ACGTGTGTTAGGAATTTTAAATTGTG -3'
(R):5'- GAGGACCTTTCAGTTTCTGTAATAGC -3'
Posted On2014-12-29