Incidental Mutation 'R0319:Kdelr2'
ID 25541
Institutional Source Beutler Lab
Gene Symbol Kdelr2
Ensembl Gene ENSMUSG00000079111
Gene Name KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Synonyms 1110007A14Rik
MMRRC Submission 038529-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.726) question?
Stock # R0319 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 143389593-143407656 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143398272 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 40 (F40I)
Ref Sequence ENSEMBL: ENSMUSP00000106359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110731]
AlphaFold Q9CQM2
Predicted Effect probably damaging
Transcript: ENSMUST00000110731
AA Change: F40I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106359
Gene: ENSMUSG00000079111
AA Change: F40I

DomainStartEndE-ValueType
Pfam:ER_lumen_recept 28 169 1.6e-57 PFAM
transmembrane domain 178 200 N/A INTRINSIC
Meta Mutation Damage Score 0.8659 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR2 was the second member of the family to be identified, and it encodes a protein which is 83% identical to the KDELR1 gene product. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 127,836,362 (GRCm39) V77G probably benign Het
Abcb1b A G 5: 8,877,428 (GRCm39) R663G probably benign Het
Acly A G 11: 100,395,808 (GRCm39) V404A probably damaging Het
Actg2 T A 6: 83,497,725 (GRCm39) I103F probably damaging Het
Anapc5 A G 5: 122,956,919 (GRCm39) V120A probably damaging Het
Ankk1 T G 9: 49,327,371 (GRCm39) T603P probably damaging Het
Ankmy2 T C 12: 36,215,898 (GRCm39) S33P possibly damaging Het
Arhgef19 A T 4: 140,983,710 (GRCm39) T748S possibly damaging Het
Atad5 T A 11: 80,011,616 (GRCm39) probably benign Het
Atxn10 T C 15: 85,249,483 (GRCm39) L105P probably damaging Het
Cacna1s T C 1: 135,998,455 (GRCm39) V161A probably damaging Het
Col6a3 T C 1: 90,735,426 (GRCm39) E741G possibly damaging Het
Cpne9 G A 6: 113,271,654 (GRCm39) G338E probably damaging Het
Cyp3a13 G A 5: 137,897,124 (GRCm39) P397S probably damaging Het
Dbn1 C T 13: 55,622,729 (GRCm39) E585K probably damaging Het
Draxin A G 4: 148,200,429 (GRCm39) L7P probably benign Het
Exosc7 T A 9: 122,960,025 (GRCm39) probably benign Het
Far2 A G 6: 148,058,968 (GRCm39) E218G probably damaging Het
Ggps1 A C 13: 14,228,462 (GRCm39) N240K possibly damaging Het
Kcnip1 T C 11: 33,601,529 (GRCm39) probably benign Het
Kcnv2 A T 19: 27,301,424 (GRCm39) Y425F probably benign Het
Kdm1b C T 13: 47,207,195 (GRCm39) P173L probably benign Het
Kif20b G A 19: 34,925,132 (GRCm39) probably benign Het
Klhl9 A T 4: 88,638,691 (GRCm39) Y517N possibly damaging Het
Lgals3bp A G 11: 118,284,347 (GRCm39) S411P probably damaging Het
Lmo3 G A 6: 138,354,309 (GRCm39) T85M probably damaging Het
Lvrn C A 18: 46,997,820 (GRCm39) T256N probably damaging Het
Malt1 T C 18: 65,595,986 (GRCm39) probably null Het
Mgst1 A G 6: 138,133,155 (GRCm39) I157V possibly damaging Het
Mob3a A T 10: 80,525,819 (GRCm39) V164E possibly damaging Het
Mprip T A 11: 59,587,864 (GRCm39) probably benign Het
Mst1 A G 9: 107,959,712 (GRCm39) N276S probably benign Het
Or5an1b A T 19: 12,299,680 (GRCm39) C170* probably null Het
P3h2 T A 16: 25,789,681 (GRCm39) I529F possibly damaging Het
Pikfyve T A 1: 65,285,490 (GRCm39) S865T probably benign Het
Rcbtb2 G A 14: 73,415,909 (GRCm39) R474Q probably benign Het
Rpl27 G A 11: 101,334,321 (GRCm39) probably benign Het
Rtp1 G A 16: 23,250,210 (GRCm39) E192K probably damaging Het
Sgk2 T C 2: 162,837,592 (GRCm39) probably benign Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc49a4 T C 16: 35,570,884 (GRCm39) D140G probably benign Het
Spdl1 T C 11: 34,714,347 (GRCm39) N114S possibly damaging Het
Syne2 C T 12: 76,110,936 (GRCm39) R5756W probably damaging Het
Tor1aip1 T C 1: 155,882,927 (GRCm39) E307G probably damaging Het
Tpd52 T C 3: 9,018,749 (GRCm39) T44A probably benign Het
Trim67 A T 8: 125,549,966 (GRCm39) Y532F probably damaging Het
Ttll9 C A 2: 152,842,018 (GRCm39) probably null Het
Ush2a T C 1: 188,680,571 (GRCm39) probably benign Het
Vcam1 T C 3: 115,909,709 (GRCm39) I539M probably benign Het
Vmn1r19 T A 6: 57,381,600 (GRCm39) M51K possibly damaging Het
Vmn2r61 T A 7: 41,949,941 (GRCm39) M787K probably damaging Het
Xdh T A 17: 74,213,096 (GRCm39) probably benign Het
Zfp109 A T 7: 23,933,895 (GRCm39) V8E probably damaging Het
Zfp595 G A 13: 67,464,577 (GRCm39) A562V possibly damaging Het
Zfp759 A G 13: 67,288,356 (GRCm39) T636A probably benign Het
Other mutations in Kdelr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Kdelr2 APN 5 143,398,330 (GRCm39) missense probably damaging 1.00
IGL01961:Kdelr2 APN 5 143,406,556 (GRCm39) missense probably benign 0.01
IGL03220:Kdelr2 APN 5 143,403,870 (GRCm39) nonsense probably null
fennel UTSW 5 143,398,272 (GRCm39) missense probably damaging 0.98
R1765:Kdelr2 UTSW 5 143,406,567 (GRCm39) nonsense probably null
R5424:Kdelr2 UTSW 5 143,403,899 (GRCm39) missense probably benign 0.03
R5488:Kdelr2 UTSW 5 143,389,784 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCTAATCAGTTGTTTCCAGAGCCT -3'
(R):5'- GGAGCCGCAAACCAAGTTCTTAGA -3'
Posted On 2013-04-16