Incidental Mutation 'R2919:Casp8ap2'
ID255412
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
MMRRC Submission 040504-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2919 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32645343 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1472 (D1472G)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect probably damaging
Transcript: ENSMUST00000029950
AA Change: D1472G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: D1472G

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000178925
AA Change: D1472G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: D1472G

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.0819 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik C T 5: 146,185,191 R27H probably benign Het
2310002L09Rik A T 4: 73,950,608 L31Q probably damaging Het
Agbl1 G A 7: 76,414,658 D53N probably damaging Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Als2cl A T 9: 110,897,499 probably null Het
Atg9b T A 5: 24,391,544 T125S possibly damaging Het
Cd1d2 C G 3: 86,987,680 P158A probably damaging Het
Cdc45 A G 16: 18,808,793 I94T probably benign Het
Chd6 T G 2: 160,967,880 D1487A possibly damaging Het
Edem2 T C 2: 155,709,027 Y340C probably damaging Het
Fbxl12 C T 9: 20,642,213 R26H probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Gm5884 A G 6: 128,645,058 noncoding transcript Het
Inpp4b C A 8: 81,985,329 A425E possibly damaging Het
Kif1a A G 1: 93,046,742 Y964H probably damaging Het
Lrp1b A C 2: 41,770,899 C66G probably damaging Het
Lrp4 A G 2: 91,490,730 I1034V probably benign Het
Mmrn2 T C 14: 34,402,922 V820A possibly damaging Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mroh9 A C 1: 163,056,772 M399R probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp2 G A 5: 65,807,098 G830D probably benign Het
Nagpa G A 16: 5,203,787 probably benign Het
Olfr1000 G A 2: 85,608,410 P167S probably benign Het
Olfr690 C T 7: 105,329,860 V111M probably damaging Het
Oxgr1 T A 14: 120,022,809 probably benign Het
Parp3 T A 9: 106,473,725 R323W possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Pfkp C T 13: 6,593,243 G513D probably damaging Het
Pla2g4d T C 2: 120,281,627 probably benign Het
Rtl1 T C 12: 109,591,148 E1419G unknown Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Sgk2 T G 2: 162,999,195 L175R probably damaging Het
Sgk2 C A 2: 162,999,205 F178L probably damaging Het
Sim1 T C 10: 50,909,815 Y255H probably benign Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc38a3 A T 9: 107,657,687 I163N probably damaging Het
Slc39a4 A G 15: 76,616,670 L31P probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Slfnl1 G T 4: 120,533,078 probably benign Het
Stradb G A 1: 58,992,669 V247M probably benign Het
Styk1 T A 6: 131,313,004 probably benign Het
Sult1d1 A G 5: 87,559,755 probably benign Het
Syk C T 13: 52,611,121 P95S probably benign Het
Taar2 T A 10: 23,941,556 N331K probably benign Het
Thsd7b A G 1: 130,189,850 probably benign Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tmbim7 G A 5: 3,673,188 probably null Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Tmem184c A T 8: 77,604,647 C158S probably damaging Het
Tmpo A G 10: 91,152,686 I310T probably benign Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Xirp1 T C 9: 120,018,701 E372G possibly damaging Het
Zbtb5 T C 4: 44,994,790 E198G probably damaging Het
Zfp804a A G 2: 82,235,816 N44D probably damaging Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32644766 missense probably damaging 1.00
R7448:Casp8ap2 UTSW 4 32643974 missense possibly damaging 0.84
R7944:Casp8ap2 UTSW 4 32645909 missense probably benign 0.12
R7945:Casp8ap2 UTSW 4 32645909 missense probably benign 0.12
R8170:Casp8ap2 UTSW 4 32615490 splice site probably benign
R8179:Casp8ap2 UTSW 4 32643939 nonsense probably null
R8207:Casp8ap2 UTSW 4 32646446 missense possibly damaging 0.63
R8263:Casp8ap2 UTSW 4 32644072 missense probably damaging 1.00
R8298:Casp8ap2 UTSW 4 32640429 missense probably benign 0.30
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAAGAGTAAGCCCTGCATCTCTTC -3'
(R):5'- CACACCATGTTTAAGGCCAGG -3'

Sequencing Primer
(F):5'- CCATACTCTTAGAAGATCTTGCGG -3'
(R):5'- CCATGTTTAAGGCCAGGGGAGG -3'
Posted On2014-12-29