Mutagenetix > Incidental Mutations

Incidental Mutation 'R2919:Casp8ap2'

255412

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

MMRRC Submission

040504-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2919 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32615451-32653265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32645343 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1472 (D1472G)

Ref Sequence

ENSEMBL: ENSMUSP00000136016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029950
AA Change: D1472G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: D1472G

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000108178

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000178925
AA Change: D1472G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: D1472G

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Meta Mutation Damage Score

0.0819

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	C	T	5: 146,185,191	R27H	probably benign	Het
2310002L09Rik	A	T	4: 73,950,608	L31Q	probably damaging	Het
Agbl1	G	A	7: 76,414,658	D53N	probably damaging	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Als2cl	A	T	9: 110,897,499		probably null	Het
Atg9b	T	A	5: 24,391,544	T125S	possibly damaging	Het
Cd1d2	C	G	3: 86,987,680	P158A	probably damaging	Het
Cdc45	A	G	16: 18,808,793	I94T	probably benign	Het
Chd6	T	G	2: 160,967,880	D1487A	possibly damaging	Het
Edem2	T	C	2: 155,709,027	Y340C	probably damaging	Het
Fbxl12	C	T	9: 20,642,213	R26H	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Gm5884	A	G	6: 128,645,058		noncoding transcript	Het
Inpp4b	C	A	8: 81,985,329	A425E	possibly damaging	Het
Kif1a	A	G	1: 93,046,742	Y964H	probably damaging	Het
Lrp1b	A	C	2: 41,770,899	C66G	probably damaging	Het
Lrp4	A	G	2: 91,490,730	I1034V	probably benign	Het
Mmrn2	T	C	14: 34,402,922	V820A	possibly damaging	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mroh9	A	C	1: 163,056,772	M399R	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
N4bp2	G	A	5: 65,807,098	G830D	probably benign	Het
Nagpa	G	A	16: 5,203,787		probably benign	Het
Olfr1000	G	A	2: 85,608,410	P167S	probably benign	Het
Olfr690	C	T	7: 105,329,860	V111M	probably damaging	Het
Oxgr1	T	A	14: 120,022,809		probably benign	Het
Parp3	T	A	9: 106,473,725	R323W	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Pfkp	C	T	13: 6,593,243	G513D	probably damaging	Het
Pla2g4d	T	C	2: 120,281,627		probably benign	Het
Rtl1	T	C	12: 109,591,148	E1419G	unknown	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Sgk2	T	G	2: 162,999,195	L175R	probably damaging	Het
Sgk2	C	A	2: 162,999,205	F178L	probably damaging	Het
Sim1	T	C	10: 50,909,815	Y255H	probably benign	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc38a3	A	T	9: 107,657,687	I163N	probably damaging	Het
Slc39a4	A	G	15: 76,616,670	L31P	probably damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Slfnl1	G	T	4: 120,533,078		probably benign	Het
Stradb	G	A	1: 58,992,669	V247M	probably benign	Het
Styk1	T	A	6: 131,313,004		probably benign	Het
Sult1d1	A	G	5: 87,559,755		probably benign	Het
Syk	C	T	13: 52,611,121	P95S	probably benign	Het
Taar2	T	A	10: 23,941,556	N331K	probably benign	Het
Thsd7b	A	G	1: 130,189,850		probably benign	Het
Tldc1	G	A	8: 119,768,317	A234V	probably benign	Het
Tmbim7	G	A	5: 3,673,188		probably null	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Tmem184c	A	T	8: 77,604,647	C158S	probably damaging	Het
Tmpo	A	G	10: 91,152,686	I310T	probably benign	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Xirp1	T	C	9: 120,018,701	E372G	possibly damaging	Het
Zbtb5	T	C	4: 44,994,790	E198G	probably damaging	Het
Zfp804a	A	G	2: 82,235,816	N44D	probably damaging	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32641433	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32649192	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32641036	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32645403	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32646182	missense	probably benign
IGL01534:Casp8ap2	APN	4	32648134	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32646365	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32641294	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32639391	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32643974	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32639704	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32630246	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32624105	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32644590	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32640185	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32643810	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32640327	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32640817	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32643797	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32640381	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32640790	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32640563	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32645687	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32648111	missense	probably damaging	0.98
R1337:Casp8ap2	UTSW	4	32645721	missense	possibly damaging	0.64
R1471:Casp8ap2	UTSW	4	32639386	nonsense	probably null
R1497:Casp8ap2	UTSW	4	32639938	missense	probably benign	0.00
R1521:Casp8ap2	UTSW	4	32631867	missense	probably damaging	1.00
R1588:Casp8ap2	UTSW	4	32640541	missense	probably benign	0.00
R1625:Casp8ap2	UTSW	4	32648068	missense	probably benign	0.04
R1731:Casp8ap2	UTSW	4	32641442	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32643647	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32634874	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32631126	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32644727	missense	probably benign	0.00
R2128:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2129:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32646411	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32643781	missense	probably benign	0.31
R4091:Casp8ap2	UTSW	4	32643611	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32646150	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32644505	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32639807	missense	probably benign
R4908:Casp8ap2	UTSW	4	32639905	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32631163	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32640554	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32641400	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32639380	missense	probably damaging	1.00
R6257:Casp8ap2	UTSW	4	32641364	missense	possibly damaging	0.94
R6289:Casp8ap2	UTSW	4	32639590	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32634813	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32641553	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32646423	missense	possibly damaging	0.64
R7015:Casp8ap2	UTSW	4	32644278	missense	probably damaging	1.00
R7033:Casp8ap2	UTSW	4	32639392	missense	probably damaging	1.00
R7072:Casp8ap2	UTSW	4	32644766	missense	probably damaging	1.00
R7448:Casp8ap2	UTSW	4	32643974	missense	possibly damaging	0.84
R7944:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R7945:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R8170:Casp8ap2	UTSW	4	32615490	splice site	probably benign
R8179:Casp8ap2	UTSW	4	32643939	nonsense	probably null
R8207:Casp8ap2	UTSW	4	32646446	missense	possibly damaging	0.63
R8263:Casp8ap2	UTSW	4	32644072	missense	probably damaging	1.00
R8298:Casp8ap2	UTSW	4	32640429	missense	probably benign	0.30
V7580:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
X0018:Casp8ap2	UTSW	4	32643738	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AAAGAGTAAGCCCTGCATCTCTTC -3'
(R):5'- CACACCATGTTTAAGGCCAGG -3'

Sequencing Primer
(F):5'- CCATACTCTTAGAAGATCTTGCGG -3'
(R):5'- CCATGTTTAAGGCCAGGGGAGG -3'

Posted On

2014-12-29