Incidental Mutation 'R2919:Ugt2b5'
ID255419
Institutional Source Beutler Lab
Gene Symbol Ugt2b5
Ensembl Gene ENSMUSG00000054630
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B5
SynonymsUdpgt-3, m-1
MMRRC Submission 040504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2919 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87124960-87140318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87125407 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 467 (F467L)
Ref Sequence ENSEMBL: ENSMUSP00000068282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067790]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067790
AA Change: F467L

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068282
Gene: ENSMUSG00000054630
AA Change: F467L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 7.9e-256 PFAM
Pfam:Glyco_tran_28_C 352 449 5.3e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113327
AA Change: F478L

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108953
Gene: ENSMUSG00000054630
AA Change: F478L

DomainStartEndE-ValueType
Pfam:UDPGT 35 538 1.3e-259 PFAM
Pfam:Glyco_tran_28_C 341 460 4.3e-8 PFAM
Meta Mutation Damage Score 0.7866 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik C T 5: 146,185,191 R27H probably benign Het
2310002L09Rik A T 4: 73,950,608 L31Q probably damaging Het
Agbl1 G A 7: 76,414,658 D53N probably damaging Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Als2cl A T 9: 110,897,499 probably null Het
Atg9b T A 5: 24,391,544 T125S possibly damaging Het
Casp8ap2 A G 4: 32,645,343 D1472G probably damaging Het
Cd1d2 C G 3: 86,987,680 P158A probably damaging Het
Cdc45 A G 16: 18,808,793 I94T probably benign Het
Chd6 T G 2: 160,967,880 D1487A possibly damaging Het
Edem2 T C 2: 155,709,027 Y340C probably damaging Het
Fbxl12 C T 9: 20,642,213 R26H probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Gm5884 A G 6: 128,645,058 noncoding transcript Het
Inpp4b C A 8: 81,985,329 A425E possibly damaging Het
Kif1a A G 1: 93,046,742 Y964H probably damaging Het
Lrp1b A C 2: 41,770,899 C66G probably damaging Het
Lrp4 A G 2: 91,490,730 I1034V probably benign Het
Mmrn2 T C 14: 34,402,922 V820A possibly damaging Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mroh9 A C 1: 163,056,772 M399R probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp2 G A 5: 65,807,098 G830D probably benign Het
Nagpa G A 16: 5,203,787 probably benign Het
Olfr1000 G A 2: 85,608,410 P167S probably benign Het
Olfr690 C T 7: 105,329,860 V111M probably damaging Het
Oxgr1 T A 14: 120,022,809 probably benign Het
Parp3 T A 9: 106,473,725 R323W possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Pfkp C T 13: 6,593,243 G513D probably damaging Het
Pla2g4d T C 2: 120,281,627 probably benign Het
Rtl1 T C 12: 109,591,148 E1419G unknown Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Sgk2 T G 2: 162,999,195 L175R probably damaging Het
Sgk2 C A 2: 162,999,205 F178L probably damaging Het
Sim1 T C 10: 50,909,815 Y255H probably benign Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc38a3 A T 9: 107,657,687 I163N probably damaging Het
Slc39a4 A G 15: 76,616,670 L31P probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Slfnl1 G T 4: 120,533,078 probably benign Het
Stradb G A 1: 58,992,669 V247M probably benign Het
Styk1 T A 6: 131,313,004 probably benign Het
Sult1d1 A G 5: 87,559,755 probably benign Het
Syk C T 13: 52,611,121 P95S probably benign Het
Taar2 T A 10: 23,941,556 N331K probably benign Het
Thsd7b A G 1: 130,189,850 probably benign Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tmbim7 G A 5: 3,673,188 probably null Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Tmem184c A T 8: 77,604,647 C158S probably damaging Het
Tmpo A G 10: 91,152,686 I310T probably benign Het
Xirp1 T C 9: 120,018,701 E372G possibly damaging Het
Zbtb5 T C 4: 44,994,790 E198G probably damaging Het
Zfp804a A G 2: 82,235,816 N44D probably damaging Het
Other mutations in Ugt2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ugt2b5 APN 5 87125219 missense probably benign 0.02
IGL00742:Ugt2b5 APN 5 87127814 missense probably damaging 1.00
IGL01527:Ugt2b5 APN 5 87136209 missense possibly damaging 0.71
IGL01530:Ugt2b5 APN 5 87137245 missense probably benign 0.08
IGL01637:Ugt2b5 APN 5 87139900 missense probably benign 0.04
IGL02371:Ugt2b5 APN 5 87127676 critical splice donor site probably null
IGL02993:Ugt2b5 APN 5 87137232 missense probably damaging 1.00
IGL03114:Ugt2b5 APN 5 87128350 missense probably damaging 1.00
R0372:Ugt2b5 UTSW 5 87140258 missense probably benign 0.05
R0568:Ugt2b5 UTSW 5 87137365 critical splice acceptor site probably benign
R0650:Ugt2b5 UTSW 5 87139768 missense probably benign 0.00
R1660:Ugt2b5 UTSW 5 87139618 missense probably benign 0.00
R1907:Ugt2b5 UTSW 5 87139630 missense probably benign 0.19
R1955:Ugt2b5 UTSW 5 87127772 missense probably benign 0.18
R2389:Ugt2b5 UTSW 5 87127682 missense probably damaging 0.98
R2435:Ugt2b5 UTSW 5 87139606 missense probably damaging 0.99
R2920:Ugt2b5 UTSW 5 87125407 missense possibly damaging 0.83
R4342:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4343:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4344:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4355:Ugt2b5 UTSW 5 87139763 nonsense probably null
R4380:Ugt2b5 UTSW 5 87127894 missense probably damaging 1.00
R4789:Ugt2b5 UTSW 5 87139691 missense probably benign 0.14
R4993:Ugt2b5 UTSW 5 87139673 missense probably benign 0.00
R5731:Ugt2b5 UTSW 5 87140252 nonsense probably null
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R6491:Ugt2b5 UTSW 5 87125469 nonsense probably null
R7015:Ugt2b5 UTSW 5 87139796 missense probably damaging 1.00
R7203:Ugt2b5 UTSW 5 87128399 missense possibly damaging 0.72
R7212:Ugt2b5 UTSW 5 87125272 missense probably benign 0.06
R7750:Ugt2b5 UTSW 5 87140249 missense probably benign 0.11
X0004:Ugt2b5 UTSW 5 87128371 nonsense probably null
X0021:Ugt2b5 UTSW 5 87136211 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAATGAGGCTGAAAGTTTGTTCATG -3'
(R):5'- GGTCATAGGACAGCTCAATGG -3'

Sequencing Primer
(F):5'- AGTTCATTGTCAGTGAGCTCTAC -3'
(R):5'- TCATAGGACAGCTCAATGGATAAG -3'
Posted On2014-12-29