Incidental Mutation 'R2919:Inpp4b'
ID255428
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Nameinositol polyphosphate-4-phosphatase, type II
SynonymsE130107I17Rik
MMRRC Submission 040504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R2919 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location81342556-82127914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81985329 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 425 (A425E)
Ref Sequence ENSEMBL: ENSMUSP00000148972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042529
AA Change: A408E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: A408E

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109851
AA Change: A293E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: A293E

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 187 204 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109852
AA Change: A425E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: A425E

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169116
AA Change: A425E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: A425E

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
Predicted Effect possibly damaging
Transcript: ENSMUST00000170160
AA Change: A240E

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940
AA Change: A240E

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172031
AA Change: A425E

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: A425E

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213285
AA Change: A425E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215332
AA Change: A425E

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217122
AA Change: A425E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1045 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik C T 5: 146,185,191 R27H probably benign Het
2310002L09Rik A T 4: 73,950,608 L31Q probably damaging Het
Agbl1 G A 7: 76,414,658 D53N probably damaging Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Als2cl A T 9: 110,897,499 probably null Het
Atg9b T A 5: 24,391,544 T125S possibly damaging Het
Casp8ap2 A G 4: 32,645,343 D1472G probably damaging Het
Cd1d2 C G 3: 86,987,680 P158A probably damaging Het
Cdc45 A G 16: 18,808,793 I94T probably benign Het
Chd6 T G 2: 160,967,880 D1487A possibly damaging Het
Edem2 T C 2: 155,709,027 Y340C probably damaging Het
Fbxl12 C T 9: 20,642,213 R26H probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Gm5884 A G 6: 128,645,058 noncoding transcript Het
Kif1a A G 1: 93,046,742 Y964H probably damaging Het
Lrp1b A C 2: 41,770,899 C66G probably damaging Het
Lrp4 A G 2: 91,490,730 I1034V probably benign Het
Mmrn2 T C 14: 34,402,922 V820A possibly damaging Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mroh9 A C 1: 163,056,772 M399R probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp2 G A 5: 65,807,098 G830D probably benign Het
Nagpa G A 16: 5,203,787 probably benign Het
Olfr1000 G A 2: 85,608,410 P167S probably benign Het
Olfr690 C T 7: 105,329,860 V111M probably damaging Het
Oxgr1 T A 14: 120,022,809 probably benign Het
Parp3 T A 9: 106,473,725 R323W possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Pfkp C T 13: 6,593,243 G513D probably damaging Het
Pla2g4d T C 2: 120,281,627 probably benign Het
Rtl1 T C 12: 109,591,148 E1419G unknown Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Sgk2 T G 2: 162,999,195 L175R probably damaging Het
Sgk2 C A 2: 162,999,205 F178L probably damaging Het
Sim1 T C 10: 50,909,815 Y255H probably benign Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc38a3 A T 9: 107,657,687 I163N probably damaging Het
Slc39a4 A G 15: 76,616,670 L31P probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Slfnl1 G T 4: 120,533,078 probably benign Het
Stradb G A 1: 58,992,669 V247M probably benign Het
Styk1 T A 6: 131,313,004 probably benign Het
Sult1d1 A G 5: 87,559,755 probably benign Het
Syk C T 13: 52,611,121 P95S probably benign Het
Taar2 T A 10: 23,941,556 N331K probably benign Het
Thsd7b A G 1: 130,189,850 probably benign Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tmbim7 G A 5: 3,673,188 probably null Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Tmem184c A T 8: 77,604,647 C158S probably damaging Het
Tmpo A G 10: 91,152,686 I310T probably benign Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Xirp1 T C 9: 120,018,701 E372G possibly damaging Het
Zbtb5 T C 4: 44,994,790 E198G probably damaging Het
Zfp804a A G 2: 82,235,816 N44D probably damaging Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 81856750 missense probably damaging 1.00
IGL01481:Inpp4b APN 8 81997380 missense probably damaging 1.00
IGL01509:Inpp4b APN 8 81890703 splice site probably benign
IGL01515:Inpp4b APN 8 81952711 missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82010663 missense probably benign 0.03
IGL01643:Inpp4b APN 8 82071771 missense probably damaging 0.97
IGL01736:Inpp4b APN 8 81997339 missense probably benign 0.00
IGL02154:Inpp4b APN 8 81969501 splice site probably benign
IGL02327:Inpp4b APN 8 82041962 missense probably benign 0.01
IGL02413:Inpp4b APN 8 82033171 missense probably benign
IGL02652:Inpp4b APN 8 81770800 splice site probably benign
IGL02678:Inpp4b APN 8 81856744 missense probably damaging 1.00
IGL03146:Inpp4b APN 8 81743781 missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 81693010 intron probably benign
PIT4280001:Inpp4b UTSW 8 82034417 missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82046267 missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82041935 missense probably damaging 1.00
R0083:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 81770917 missense probably benign 0.00
R0285:Inpp4b UTSW 8 82034516 splice site probably benign
R0363:Inpp4b UTSW 8 81884257 splice site probably benign
R0364:Inpp4b UTSW 8 81997314 missense probably benign 0.09
R0471:Inpp4b UTSW 8 82041899 missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 81997337 missense probably benign 0.00
R0562:Inpp4b UTSW 8 81768151 missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 81997314 missense probably benign 0.09
R1081:Inpp4b UTSW 8 82069024 missense probably damaging 0.97
R1251:Inpp4b UTSW 8 81890753 missense probably benign 0.01
R1374:Inpp4b UTSW 8 81743816 critical splice donor site probably null
R1445:Inpp4b UTSW 8 81952834 intron probably null
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1647:Inpp4b UTSW 8 81856774 splice site probably benign
R1754:Inpp4b UTSW 8 81770811 missense probably damaging 1.00
R1759:Inpp4b UTSW 8 81768103 missense probably benign 0.06
R2085:Inpp4b UTSW 8 81952274 missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82048489 missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82121375 nonsense probably null
R2175:Inpp4b UTSW 8 81856699 missense probably damaging 1.00
R2191:Inpp4b UTSW 8 81997302 missense probably damaging 1.00
R2401:Inpp4b UTSW 8 81997339 missense probably benign 0.00
R2475:Inpp4b UTSW 8 82041978 missense probably benign 0.09
R2512:Inpp4b UTSW 8 82010550 missense probably damaging 1.00
R3021:Inpp4b UTSW 8 81902838 missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 81952261 missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82041992 missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82041992 missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R4590:Inpp4b UTSW 8 81741411 start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 81969535 missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82122653 missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82122624 missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82033208 missense probably damaging 1.00
R5219:Inpp4b UTSW 8 81884156 missense probably benign 0.01
R5228:Inpp4b UTSW 8 81768115 missense probably damaging 0.99
R5557:Inpp4b UTSW 8 81952259 missense probably damaging 0.99
R5627:Inpp4b UTSW 8 81743816 critical splice donor site probably benign
R5691:Inpp4b UTSW 8 81890694 intron probably benign
R6186:Inpp4b UTSW 8 82046234 missense probably damaging 0.99
R6213:Inpp4b UTSW 8 81997390 missense probably damaging 1.00
R6232:Inpp4b UTSW 8 81952184 missense probably damaging 1.00
R6283:Inpp4b UTSW 8 81770833 missense probably damaging 1.00
R6302:Inpp4b UTSW 8 81768177 missense probably benign 0.00
R6309:Inpp4b UTSW 8 82041917 missense probably damaging 1.00
R6360:Inpp4b UTSW 8 81902852 missense probably benign 0.20
R6477:Inpp4b UTSW 8 81844714 unclassified probably null
R6773:Inpp4b UTSW 8 81856620 intron probably benign
R6968:Inpp4b UTSW 8 81844457 missense probably benign 0.18
R7147:Inpp4b UTSW 8 81902771 missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82071745 missense probably damaging 1.00
R7409:Inpp4b UTSW 8 81952685 splice site probably null
R7455:Inpp4b UTSW 8 82071703 missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82046339 missense probably damaging 1.00
R7844:Inpp4b UTSW 8 81741320 start gained probably benign
R7927:Inpp4b UTSW 8 81741320 start gained probably benign
RF003:Inpp4b UTSW 8 81969521 nonsense probably null
Z1088:Inpp4b UTSW 8 82068931 critical splice acceptor site probably null
Z1176:Inpp4b UTSW 8 82069001 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CAAAGGCTGGATTTACATTTAGCC -3'
(R):5'- TGATCCCGTGGCAATGCTTTG -3'

Sequencing Primer
(F):5'- TCTCACCTCTGTACTTATTTGGTAAG -3'
(R):5'- CCGTGGCAATGCTTTGAAGTTTAC -3'
Posted On2014-12-29