Mutagenetix > Incidental Mutations

Incidental Mutation 'R2919:Inpp4b'

255428

Institutional Source

Beutler Lab

Gene Symbol

Inpp4b

Ensembl Gene

ENSMUSG00000037940

Gene Name

inositol polyphosphate-4-phosphatase, type II

Synonyms

E130107I17Rik

MMRRC Submission

040504-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.309) question?

Stock #

R2919 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81342556-82127914 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81985329 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 425 (A425E)

Ref Sequence

ENSEMBL: ENSMUSP00000148972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042529
AA Change: A408E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: A408E

Domain	Start	End	E-Value	Type
C2	40	147	1.72e0	SMART
low complexity region	302	319	N/A	INTRINSIC
low complexity region	425	434	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109851
AA Change: A293E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: A293E

Domain	Start	End	E-Value	Type
low complexity region	22	35	N/A	INTRINSIC
low complexity region	187	204	N/A	INTRINSIC
low complexity region	310	319	N/A	INTRINSIC
transmembrane domain	783	805	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109852
AA Change: A425E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: A425E

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC
transmembrane domain	915	937	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169116
AA Change: A425E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: A425E

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169387

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170160
AA Change: A240E

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940
AA Change: A240E

Domain	Start	End	E-Value	Type
low complexity region	134	151	N/A	INTRINSIC
low complexity region	257	266	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172031
AA Change: A425E

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: A425E

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213285
AA Change: A425E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215332
AA Change: A425E

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217122
AA Change: A425E

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

Meta Mutation Damage Score

0.1045

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	C	T	5: 146,185,191	R27H	probably benign	Het
2310002L09Rik	A	T	4: 73,950,608	L31Q	probably damaging	Het
Agbl1	G	A	7: 76,414,658	D53N	probably damaging	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Als2cl	A	T	9: 110,897,499		probably null	Het
Atg9b	T	A	5: 24,391,544	T125S	possibly damaging	Het
Casp8ap2	A	G	4: 32,645,343	D1472G	probably damaging	Het
Cd1d2	C	G	3: 86,987,680	P158A	probably damaging	Het
Cdc45	A	G	16: 18,808,793	I94T	probably benign	Het
Chd6	T	G	2: 160,967,880	D1487A	possibly damaging	Het
Edem2	T	C	2: 155,709,027	Y340C	probably damaging	Het
Fbxl12	C	T	9: 20,642,213	R26H	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Gm5884	A	G	6: 128,645,058		noncoding transcript	Het
Kif1a	A	G	1: 93,046,742	Y964H	probably damaging	Het
Lrp1b	A	C	2: 41,770,899	C66G	probably damaging	Het
Lrp4	A	G	2: 91,490,730	I1034V	probably benign	Het
Mmrn2	T	C	14: 34,402,922	V820A	possibly damaging	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mroh9	A	C	1: 163,056,772	M399R	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
N4bp2	G	A	5: 65,807,098	G830D	probably benign	Het
Nagpa	G	A	16: 5,203,787		probably benign	Het
Olfr1000	G	A	2: 85,608,410	P167S	probably benign	Het
Olfr690	C	T	7: 105,329,860	V111M	probably damaging	Het
Oxgr1	T	A	14: 120,022,809		probably benign	Het
Parp3	T	A	9: 106,473,725	R323W	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Pfkp	C	T	13: 6,593,243	G513D	probably damaging	Het
Pla2g4d	T	C	2: 120,281,627		probably benign	Het
Rtl1	T	C	12: 109,591,148	E1419G	unknown	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Sgk2	T	G	2: 162,999,195	L175R	probably damaging	Het
Sgk2	C	A	2: 162,999,205	F178L	probably damaging	Het
Sim1	T	C	10: 50,909,815	Y255H	probably benign	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc38a3	A	T	9: 107,657,687	I163N	probably damaging	Het
Slc39a4	A	G	15: 76,616,670	L31P	probably damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Slfnl1	G	T	4: 120,533,078		probably benign	Het
Stradb	G	A	1: 58,992,669	V247M	probably benign	Het
Styk1	T	A	6: 131,313,004		probably benign	Het
Sult1d1	A	G	5: 87,559,755		probably benign	Het
Syk	C	T	13: 52,611,121	P95S	probably benign	Het
Taar2	T	A	10: 23,941,556	N331K	probably benign	Het
Thsd7b	A	G	1: 130,189,850		probably benign	Het
Tldc1	G	A	8: 119,768,317	A234V	probably benign	Het
Tmbim7	G	A	5: 3,673,188		probably null	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Tmem184c	A	T	8: 77,604,647	C158S	probably damaging	Het
Tmpo	A	G	10: 91,152,686	I310T	probably benign	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Xirp1	T	C	9: 120,018,701	E372G	possibly damaging	Het
Zbtb5	T	C	4: 44,994,790	E198G	probably damaging	Het
Zfp804a	A	G	2: 82,235,816	N44D	probably damaging	Het

Other mutations in Inpp4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Inpp4b	APN	8	81856750	missense	probably damaging	1.00
IGL01481:Inpp4b	APN	8	81997380	missense	probably damaging	1.00
IGL01509:Inpp4b	APN	8	81890703	splice site	probably benign
IGL01515:Inpp4b	APN	8	81952711	missense	possibly damaging	0.68
IGL01607:Inpp4b	APN	8	82010663	missense	probably benign	0.03
IGL01643:Inpp4b	APN	8	82071771	missense	probably damaging	0.97
IGL01736:Inpp4b	APN	8	81997339	missense	probably benign	0.00
IGL02154:Inpp4b	APN	8	81969501	splice site	probably benign
IGL02327:Inpp4b	APN	8	82041962	missense	probably benign	0.01
IGL02413:Inpp4b	APN	8	82033171	missense	probably benign
IGL02652:Inpp4b	APN	8	81770800	splice site	probably benign
IGL02678:Inpp4b	APN	8	81856744	missense	probably damaging	1.00
IGL03146:Inpp4b	APN	8	81743781	missense	possibly damaging	0.61
LCD18:Inpp4b	UTSW	8	81693010	intron	probably benign
PIT4280001:Inpp4b	UTSW	8	82034417	missense	probably benign	0.00
PIT4480001:Inpp4b	UTSW	8	82046267	missense	probably damaging	1.00
PIT4504001:Inpp4b	UTSW	8	82041935	missense	probably damaging	1.00
R0083:Inpp4b	UTSW	8	81741462	missense	possibly damaging	0.77
R0212:Inpp4b	UTSW	8	81770917	missense	probably benign	0.00
R0285:Inpp4b	UTSW	8	82034516	splice site	probably benign
R0363:Inpp4b	UTSW	8	81884257	splice site	probably benign
R0364:Inpp4b	UTSW	8	81997314	missense	probably benign	0.09
R0471:Inpp4b	UTSW	8	82041899	missense	possibly damaging	0.94
R0550:Inpp4b	UTSW	8	81997337	missense	probably benign	0.00
R0562:Inpp4b	UTSW	8	81768151	missense	possibly damaging	0.88
R0661:Inpp4b	UTSW	8	81741462	missense	possibly damaging	0.77
R0693:Inpp4b	UTSW	8	81997314	missense	probably benign	0.09
R1081:Inpp4b	UTSW	8	82069024	missense	probably damaging	0.97
R1251:Inpp4b	UTSW	8	81890753	missense	probably benign	0.01
R1374:Inpp4b	UTSW	8	81743816	critical splice donor site	probably null
R1445:Inpp4b	UTSW	8	81952834	splice site	probably null
R1465:Inpp4b	UTSW	8	81768157	missense	probably damaging	1.00
R1465:Inpp4b	UTSW	8	81768157	missense	probably damaging	1.00
R1647:Inpp4b	UTSW	8	81856774	splice site	probably benign
R1754:Inpp4b	UTSW	8	81770811	missense	probably damaging	1.00
R1759:Inpp4b	UTSW	8	81768103	missense	probably benign	0.06
R2085:Inpp4b	UTSW	8	81952274	missense	probably damaging	1.00
R2156:Inpp4b	UTSW	8	82048489	missense	probably damaging	1.00
R2160:Inpp4b	UTSW	8	82121375	nonsense	probably null
R2175:Inpp4b	UTSW	8	81856699	missense	probably damaging	1.00
R2191:Inpp4b	UTSW	8	81997302	missense	probably damaging	1.00
R2401:Inpp4b	UTSW	8	81997339	missense	probably benign	0.00
R2475:Inpp4b	UTSW	8	82041978	missense	probably benign	0.09
R2512:Inpp4b	UTSW	8	82010550	missense	probably damaging	1.00
R3021:Inpp4b	UTSW	8	81902838	missense	possibly damaging	0.47
R3423:Inpp4b	UTSW	8	81952261	missense	possibly damaging	0.63
R3777:Inpp4b	UTSW	8	82041992	missense	possibly damaging	0.89
R3778:Inpp4b	UTSW	8	82041992	missense	possibly damaging	0.89
R3794:Inpp4b	UTSW	8	82033216	missense	probably damaging	1.00
R3795:Inpp4b	UTSW	8	82033216	missense	probably damaging	1.00
R4590:Inpp4b	UTSW	8	81741411	start codon destroyed	probably null	1.00
R4602:Inpp4b	UTSW	8	81969535	missense	probably damaging	0.99
R4691:Inpp4b	UTSW	8	82122653	missense	probably damaging	1.00
R4924:Inpp4b	UTSW	8	82122624	missense	probably damaging	1.00
R4992:Inpp4b	UTSW	8	82033208	missense	probably damaging	1.00
R5219:Inpp4b	UTSW	8	81884156	missense	probably benign	0.01
R5228:Inpp4b	UTSW	8	81768115	missense	probably damaging	0.99
R5557:Inpp4b	UTSW	8	81952259	missense	probably damaging	0.99
R5627:Inpp4b	UTSW	8	81743816	critical splice donor site	probably benign
R5691:Inpp4b	UTSW	8	81890694	intron	probably benign
R6186:Inpp4b	UTSW	8	82046234	missense	probably damaging	0.99
R6213:Inpp4b	UTSW	8	81997390	missense	probably damaging	1.00
R6232:Inpp4b	UTSW	8	81952184	missense	probably damaging	1.00
R6283:Inpp4b	UTSW	8	81770833	missense	probably damaging	1.00
R6302:Inpp4b	UTSW	8	81768177	missense	probably benign	0.00
R6309:Inpp4b	UTSW	8	82041917	missense	probably damaging	1.00
R6360:Inpp4b	UTSW	8	81902852	missense	probably benign	0.20
R6477:Inpp4b	UTSW	8	81844714	splice site	probably null
R6773:Inpp4b	UTSW	8	81856620	intron	probably benign
R6968:Inpp4b	UTSW	8	81844457	missense	probably benign	0.18
R7147:Inpp4b	UTSW	8	81902771	missense	probably damaging	1.00
R7318:Inpp4b	UTSW	8	82071745	missense	probably damaging	1.00
R7409:Inpp4b	UTSW	8	81952685	splice site	probably null
R7455:Inpp4b	UTSW	8	82071703	missense	probably damaging	0.99
R7632:Inpp4b	UTSW	8	82046339	missense	probably damaging	1.00
R7844:Inpp4b	UTSW	8	81741320	start gained	probably benign
R7958:Inpp4b	UTSW	8	81969589	missense	probably damaging	1.00
R8440:Inpp4b	UTSW	8	82041895	missense	probably damaging	1.00
RF003:Inpp4b	UTSW	8	81969521	nonsense	probably null
Z1088:Inpp4b	UTSW	8	82068931	critical splice acceptor site	probably null
Z1176:Inpp4b	UTSW	8	82069001	missense	possibly damaging	0.60

Predicted Primers

PCR Primer
(F):5'- CAAAGGCTGGATTTACATTTAGCC -3'
(R):5'- TGATCCCGTGGCAATGCTTTG -3'

Sequencing Primer
(F):5'- TCTCACCTCTGTACTTATTTGGTAAG -3'
(R):5'- CCGTGGCAATGCTTTGAAGTTTAC -3'

Posted On

2014-12-29