Incidental Mutation 'R2919:Mslnl'
ID 255449
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 040504-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2919 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25955016-25967304 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25961908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
AlphaFold Q8C160
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.2148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik C T 5: 146,122,001 (GRCm39) R27H probably benign Het
2310002L09Rik A T 4: 73,868,845 (GRCm39) L31Q probably damaging Het
Agbl1 G A 7: 76,064,406 (GRCm39) D53N probably damaging Het
Aloxe3 C T 11: 69,033,749 (GRCm39) T621I probably damaging Het
Als2cl A T 9: 110,726,567 (GRCm39) probably null Het
Atg9b T A 5: 24,596,542 (GRCm39) T125S possibly damaging Het
Casp8ap2 A G 4: 32,645,343 (GRCm39) D1472G probably damaging Het
Cd1d2 C G 3: 86,894,987 (GRCm39) P158A probably damaging Het
Cdc45 A G 16: 18,627,543 (GRCm39) I94T probably benign Het
Chd6 T G 2: 160,809,800 (GRCm39) D1487A possibly damaging Het
Edem2 T C 2: 155,550,947 (GRCm39) Y340C probably damaging Het
Fbxl12 C T 9: 20,553,509 (GRCm39) R26H probably damaging Het
Fgfr3 A G 5: 33,891,284 (GRCm39) N516S probably damaging Het
Gm5884 A G 6: 128,622,021 (GRCm39) noncoding transcript Het
Hdac1-ps A G 17: 78,800,275 (GRCm39) D422G probably damaging Het
Inpp4b C A 8: 82,711,958 (GRCm39) A425E possibly damaging Het
Kif1a A G 1: 92,974,464 (GRCm39) Y964H probably damaging Het
Lrp1b A C 2: 41,660,911 (GRCm39) C66G probably damaging Het
Lrp4 A G 2: 91,321,075 (GRCm39) I1034V probably benign Het
Meak7 G A 8: 120,495,056 (GRCm39) A234V probably benign Het
Mmrn2 T C 14: 34,124,879 (GRCm39) V820A possibly damaging Het
Mphosph9 G A 5: 124,399,069 (GRCm39) T982I probably benign Het
Mroh9 A C 1: 162,884,341 (GRCm39) M399R probably damaging Het
N4bp2 G A 5: 65,964,441 (GRCm39) G830D probably benign Het
Nagpa G A 16: 5,021,651 (GRCm39) probably benign Het
Or52b1 C T 7: 104,979,067 (GRCm39) V111M probably damaging Het
Or5g23 G A 2: 85,438,754 (GRCm39) P167S probably benign Het
Oxgr1 T A 14: 120,260,221 (GRCm39) probably benign Het
Parp3 T A 9: 106,350,924 (GRCm39) R323W possibly damaging Het
Pfkfb3 C T 2: 11,489,138 (GRCm39) V286I probably benign Het
Pfkp C T 13: 6,643,279 (GRCm39) G513D probably damaging Het
Pla2g4d T C 2: 120,112,108 (GRCm39) probably benign Het
Rtl1 T C 12: 109,557,582 (GRCm39) E1419G unknown Het
Sdf2 G C 11: 78,145,680 (GRCm39) V126L probably damaging Het
Sgk2 T G 2: 162,841,115 (GRCm39) L175R probably damaging Het
Sgk2 C A 2: 162,841,125 (GRCm39) F178L probably damaging Het
Sim1 T C 10: 50,785,911 (GRCm39) Y255H probably benign Het
Slc13a5 T C 11: 72,138,617 (GRCm39) E442G possibly damaging Het
Slc38a3 A T 9: 107,534,886 (GRCm39) I163N probably damaging Het
Slc39a4 A G 15: 76,500,870 (GRCm39) L31P probably damaging Het
Slc5a11 GGTGC G 7: 122,838,595 (GRCm39) probably null Het
Slfnl1 G T 4: 120,390,275 (GRCm39) probably benign Het
Stradb G A 1: 59,031,828 (GRCm39) V247M probably benign Het
Styk1 T A 6: 131,289,967 (GRCm39) probably benign Het
Sult1d1 A G 5: 87,707,614 (GRCm39) probably benign Het
Syk C T 13: 52,765,157 (GRCm39) P95S probably benign Het
Taar2 T A 10: 23,817,454 (GRCm39) N331K probably benign Het
Thsd7b A G 1: 130,117,587 (GRCm39) probably benign Het
Tmbim7 G A 5: 3,723,188 (GRCm39) probably null Het
Tmem107 T C 11: 68,962,247 (GRCm39) L68P probably damaging Het
Tmem184c A T 8: 78,331,276 (GRCm39) C158S probably damaging Het
Tmpo A G 10: 90,988,548 (GRCm39) I310T probably benign Het
Ugt2b5 A G 5: 87,273,266 (GRCm39) F467L possibly damaging Het
Xirp1 T C 9: 119,847,767 (GRCm39) E372G possibly damaging Het
Zbtb5 T C 4: 44,994,790 (GRCm39) E198G probably damaging Het
Zfp804a A G 2: 82,066,160 (GRCm39) N44D probably damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25,962,641 (GRCm39) unclassified probably benign
IGL01629:Mslnl APN 17 25,963,749 (GRCm39) missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25,965,125 (GRCm39) missense probably benign 0.07
IGL02408:Mslnl APN 17 25,966,972 (GRCm39) missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25,963,077 (GRCm39) critical splice donor site probably null
IGL03387:Mslnl APN 17 25,963,051 (GRCm39) missense probably benign 0.06
R0561:Mslnl UTSW 17 25,962,177 (GRCm39) nonsense probably null
R0881:Mslnl UTSW 17 25,961,939 (GRCm39) missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1296:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1582:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1629:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1630:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1631:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1632:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1794:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1850:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1866:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1876:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1914:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2166:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2241:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2243:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2247:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2282:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2284:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2852:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2877:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2878:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2920:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3026:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3405:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3406:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3411:Mslnl UTSW 17 25,963,491 (GRCm39) missense probably benign 0.05
R3434:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3546:Mslnl UTSW 17 25,963,943 (GRCm39) missense probably damaging 0.98
R3612:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3729:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3730:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3802:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3804:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3894:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3895:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4454:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4455:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4456:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4457:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4561:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4562:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4564:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4600:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4601:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4610:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4704:Mslnl UTSW 17 25,957,952 (GRCm39) missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25,957,942 (GRCm39) nonsense probably null
R5257:Mslnl UTSW 17 25,965,139 (GRCm39) missense probably benign 0.00
R5456:Mslnl UTSW 17 25,962,133 (GRCm39) missense probably damaging 0.98
R5645:Mslnl UTSW 17 25,956,816 (GRCm39) missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25,965,749 (GRCm39) missense probably benign 0.00
R6083:Mslnl UTSW 17 25,956,876 (GRCm39) missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25,963,531 (GRCm39) missense probably damaging 1.00
R6761:Mslnl UTSW 17 25,965,047 (GRCm39) missense probably damaging 1.00
R7058:Mslnl UTSW 17 25,962,186 (GRCm39) missense probably benign 0.03
R7156:Mslnl UTSW 17 25,962,184 (GRCm39) missense probably benign 0.20
R7467:Mslnl UTSW 17 25,955,895 (GRCm39) start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25,962,157 (GRCm39) missense probably damaging 0.97
R7807:Mslnl UTSW 17 25,965,751 (GRCm39) missense probably benign 0.03
R8682:Mslnl UTSW 17 25,965,962 (GRCm39) missense probably benign
R8735:Mslnl UTSW 17 25,964,062 (GRCm39) missense probably benign 0.09
R8742:Mslnl UTSW 17 25,964,047 (GRCm39) missense probably damaging 1.00
R9208:Mslnl UTSW 17 25,961,694 (GRCm39) missense possibly damaging 0.94
R9264:Mslnl UTSW 17 25,961,506 (GRCm39) intron probably benign
RF007:Mslnl UTSW 17 25,962,202 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCCATCAGAAGGGAGGTTTG -3'
(R):5'- CACAGGTCTGAAGCACTGAG -3'

Sequencing Primer
(F):5'- TTTGAACCCAGGACTGAGGTGAC -3'
(R):5'- GCCCTGCCGAGACAGTAG -3'
Posted On 2014-12-29