Incidental Mutation 'R0319:Actg2'
ID25545
Institutional Source Beutler Lab
Gene Symbol Actg2
Ensembl Gene ENSMUSG00000059430
Gene Nameactin, gamma 2, smooth muscle, enteric
SynonymsAct4, Act-4, ACTA3, SMGA
MMRRC Submission 038529-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0319 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83512905-83536265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83520743 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 103 (I103F)
Ref Sequence ENSEMBL: ENSMUSP00000146302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075161] [ENSMUST00000121731] [ENSMUST00000141904] [ENSMUST00000152029] [ENSMUST00000205926]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075161
AA Change: I176F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074658
Gene: ENSMUSG00000059430
AA Change: I176F

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121731
AA Change: I176F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113552
Gene: ENSMUSG00000059430
AA Change: I176F

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124933
Predicted Effect possibly damaging
Transcript: ENSMUST00000141904
AA Change: I176F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120936
Gene: ENSMUSG00000059430
AA Change: I176F

DomainStartEndE-ValueType
ACTIN 6 270 4.78e-116 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152029
AA Change: I176F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121577
Gene: ENSMUSG00000059430
AA Change: I176F

DomainStartEndE-ValueType
ACTIN 6 195 1.09e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205926
AA Change: I103F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.8554 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,237,190 V77G probably benign Het
Abcb1b A G 5: 8,827,428 R663G probably benign Het
Acly A G 11: 100,504,982 V404A probably damaging Het
Anapc5 A G 5: 122,818,856 V120A probably damaging Het
Ankk1 T G 9: 49,416,071 T603P probably damaging Het
Ankmy2 T C 12: 36,165,899 S33P possibly damaging Het
Arhgef19 A T 4: 141,256,399 T748S possibly damaging Het
Atad5 T A 11: 80,120,790 probably benign Het
Atxn10 T C 15: 85,365,282 L105P probably damaging Het
Cacna1s T C 1: 136,070,717 V161A probably damaging Het
Col6a3 T C 1: 90,807,704 E741G possibly damaging Het
Cpne9 G A 6: 113,294,693 G338E probably damaging Het
Cyp3a13 G A 5: 137,898,862 P397S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dirc2 T C 16: 35,750,514 D140G probably benign Het
Draxin A G 4: 148,115,972 L7P probably benign Het
Exosc7 T A 9: 123,130,960 probably benign Het
Far2 A G 6: 148,157,470 E218G probably damaging Het
Ggps1 A C 13: 14,053,877 N240K possibly damaging Het
Kcnip1 T C 11: 33,651,529 probably benign Het
Kcnv2 A T 19: 27,324,024 Y425F probably benign Het
Kdelr2 T A 5: 143,412,517 F40I probably damaging Het
Kdm1b C T 13: 47,053,719 P173L probably benign Het
Kif20b G A 19: 34,947,732 probably benign Het
Klhl9 A T 4: 88,720,454 Y517N possibly damaging Het
Lgals3bp A G 11: 118,393,521 S411P probably damaging Het
Lmo3 G A 6: 138,377,311 T85M probably damaging Het
Lvrn C A 18: 46,864,753 T256N probably damaging Het
Malt1 T C 18: 65,462,915 probably null Het
Mgst1 A G 6: 138,156,157 I157V possibly damaging Het
Mob3a A T 10: 80,689,985 V164E possibly damaging Het
Mprip T A 11: 59,697,038 probably benign Het
Mst1 A G 9: 108,082,513 N276S probably benign Het
Olfr1437 A T 19: 12,322,316 C170* probably null Het
P3h2 T A 16: 25,970,931 I529F possibly damaging Het
Pikfyve T A 1: 65,246,331 S865T probably benign Het
Rcbtb2 G A 14: 73,178,469 R474Q probably benign Het
Rpl27 G A 11: 101,443,495 probably benign Het
Rtp1 G A 16: 23,431,460 E192K probably damaging Het
Sgk2 T C 2: 162,995,672 probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Spdl1 T C 11: 34,823,520 N114S possibly damaging Het
Syne2 C T 12: 76,064,162 R5756W probably damaging Het
Tor1aip1 T C 1: 156,007,181 E307G probably damaging Het
Tpd52 T C 3: 8,953,689 T44A probably benign Het
Trim67 A T 8: 124,823,227 Y532F probably damaging Het
Ttll9 C A 2: 153,000,098 probably null Het
Ush2a T C 1: 188,948,374 probably benign Het
Vcam1 T C 3: 116,116,060 I539M probably benign Het
Vmn1r19 T A 6: 57,404,615 M51K possibly damaging Het
Vmn2r61 T A 7: 42,300,517 M787K probably damaging Het
Xdh T A 17: 73,906,101 probably benign Het
Zfp109 A T 7: 24,234,470 V8E probably damaging Het
Zfp595 G A 13: 67,316,513 A562V possibly damaging Het
Zfp759 A G 13: 67,140,292 T636A probably benign Het
Other mutations in Actg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Actg2 APN 6 83523175 missense probably damaging 1.00
PIT4508001:Actg2 UTSW 6 83513007 missense possibly damaging 0.92
R0309:Actg2 UTSW 6 83519914 missense probably damaging 1.00
R1253:Actg2 UTSW 6 83522887 missense probably damaging 1.00
R1619:Actg2 UTSW 6 83523187 missense probably damaging 1.00
R1677:Actg2 UTSW 6 83522819 missense possibly damaging 0.92
R2512:Actg2 UTSW 6 83526847 missense probably damaging 1.00
R4127:Actg2 UTSW 6 83522884 missense possibly damaging 0.86
R4195:Actg2 UTSW 6 83523173 missense probably damaging 1.00
R5165:Actg2 UTSW 6 83526832 missense probably benign 0.22
R5661:Actg2 UTSW 6 83520772 missense probably damaging 0.98
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6707:Actg2 UTSW 6 83513094 nonsense probably null
R7069:Actg2 UTSW 6 83520763 missense probably damaging 1.00
R7763:Actg2 UTSW 6 83527368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACTAGGCTGTCTTACCACTGC -3'
(R):5'- AAACTGACAAGTGTCCCTTACCACG -3'

Sequencing Primer
(F):5'- TCAGCCTGAGGACAGAGC -3'
(R):5'- agagagagagagacagagagag -3'
Posted On2013-04-16