Incidental Mutation 'R2920:Glb1l'
ID 255451
Institutional Source Beutler Lab
Gene Symbol Glb1l
Ensembl Gene ENSMUSG00000026200
Gene Name galactosidase, beta 1-like
Synonyms 4833408P15Rik
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75198236-75210813 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75209190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 31 (E31D)
Ref Sequence ENSEMBL: ENSMUSP00000140820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027401] [ENSMUST00000113623] [ENSMUST00000123825] [ENSMUST00000144355] [ENSMUST00000155716] [ENSMUST00000185448] [ENSMUST00000189698] [ENSMUST00000191108] [ENSMUST00000188460]
AlphaFold Q8VC60
Predicted Effect probably benign
Transcript: ENSMUST00000027401
SMART Domains Protein: ENSMUSP00000027401
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 290 3.3e-47 PFAM
Pfam:Pkinase_Tyr 21 290 3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113623
AA Change: E31D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109253
Gene: ENSMUSG00000026200
AA Change: E31D

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.1e-123 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123825
SMART Domains Protein: ENSMUSP00000122688
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142052
Predicted Effect probably benign
Transcript: ENSMUST00000144355
SMART Domains Protein: ENSMUSP00000115964
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145144
Predicted Effect probably benign
Transcript: ENSMUST00000155716
AA Change: E31D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136285
Gene: ENSMUSG00000026200
AA Change: E31D

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.2e-125 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185448
AA Change: E31D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140820
Gene: ENSMUSG00000026200
AA Change: E31D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 188 1.6e-71 PFAM
Pfam:Glyco_hydro_42 48 188 6.4e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186173
AA Change: E25D
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189242
Predicted Effect probably benign
Transcript: ENSMUST00000189698
SMART Domains Protein: ENSMUSP00000140329
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 203 1.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191108
SMART Domains Protein: ENSMUSP00000139846
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 186 8.6e-29 PFAM
Pfam:Pkinase_Tyr 21 184 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188460
SMART Domains Protein: ENSMUSP00000139998
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 172 1e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Glb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Glb1l APN 1 75201238 missense probably damaging 0.99
IGL01477:Glb1l APN 1 75208706 missense probably damaging 1.00
R0408:Glb1l UTSW 1 75208835 missense probably damaging 1.00
R0620:Glb1l UTSW 1 75199720 missense probably damaging 1.00
R1639:Glb1l UTSW 1 75199601 missense probably benign 0.16
R1842:Glb1l UTSW 1 75200460 missense probably damaging 0.96
R2508:Glb1l UTSW 1 75201829 missense probably damaging 0.99
R3439:Glb1l UTSW 1 75202620 missense probably damaging 1.00
R4096:Glb1l UTSW 1 75209440 start codon destroyed probably benign 0.01
R4517:Glb1l UTSW 1 75208703 missense probably damaging 1.00
R4829:Glb1l UTSW 1 75200350 missense probably damaging 0.96
R4851:Glb1l UTSW 1 75208884 unclassified probably benign
R4859:Glb1l UTSW 1 75200319 splice site probably benign
R4951:Glb1l UTSW 1 75208375 missense probably damaging 1.00
R6163:Glb1l UTSW 1 75201407 missense probably benign
R6519:Glb1l UTSW 1 75201056 missense probably benign 0.41
R6693:Glb1l UTSW 1 75209101 missense probably damaging 1.00
R6713:Glb1l UTSW 1 75202417 missense probably benign 0.02
R6833:Glb1l UTSW 1 75201753 missense possibly damaging 0.93
R6834:Glb1l UTSW 1 75201753 missense possibly damaging 0.93
R7068:Glb1l UTSW 1 75202737 missense probably damaging 1.00
R7453:Glb1l UTSW 1 75202706 missense probably damaging 1.00
R7694:Glb1l UTSW 1 75201792 missense probably damaging 1.00
R8784:Glb1l UTSW 1 75200331 missense probably damaging 1.00
R9408:Glb1l UTSW 1 75201039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCAGTTTTCCTGGGGAAC -3'
(R):5'- CTGTCCCAGGTAAACCCAAAGG -3'

Sequencing Primer
(F):5'- GAACCCCATTCTAAGGAAGAGG -3'
(R):5'- AAAGGGTCGGACTGTCTGC -3'
Posted On 2014-12-29