Incidental Mutation 'R2920:Pak6'
ID255453
Institutional Source Beutler Lab
Gene Symbol Pak6
Ensembl Gene ENSMUSG00000074923
Gene Namep21 (RAC1) activated kinase 6
Synonyms
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2920 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118663303-118698020 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 118694007 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099557] [ENSMUST00000110853]
Predicted Effect probably benign
Transcript: ENSMUST00000099557
SMART Domains Protein: ENSMUSP00000097153
Gene: ENSMUSG00000074923

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110853
SMART Domains Protein: ENSMUSP00000106477
Gene: ENSMUSG00000074923

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132577
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele do not exhibit any abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Pak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pak6 APN 2 118689845 missense possibly damaging 0.58
IGL00979:Pak6 APN 2 118696482 missense probably damaging 1.00
IGL01577:Pak6 APN 2 118693648 missense probably benign 0.00
IGL01928:Pak6 APN 2 118689864 missense probably damaging 1.00
IGL01951:Pak6 APN 2 118693260 missense probably benign
IGL02387:Pak6 APN 2 118693233 missense probably benign
IGL03302:Pak6 APN 2 118693303 missense probably benign
bedamned UTSW 2 118694007 splice site probably benign
bequeathed UTSW 2 118693522 missense probably damaging 0.96
R0126:Pak6 UTSW 2 118690332 missense possibly damaging 0.86
R0883:Pak6 UTSW 2 118693687 missense probably damaging 1.00
R1128:Pak6 UTSW 2 118696509 missense probably benign 0.00
R2073:Pak6 UTSW 2 118688851 missense probably damaging 1.00
R2508:Pak6 UTSW 2 118694569 nonsense probably null
R3118:Pak6 UTSW 2 118689741 missense probably damaging 1.00
R3689:Pak6 UTSW 2 118693440 nonsense probably null
R3762:Pak6 UTSW 2 118696477 missense probably damaging 0.99
R4589:Pak6 UTSW 2 118696540 missense probably damaging 1.00
R4976:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5119:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5206:Pak6 UTSW 2 118693303 missense probably benign
R5683:Pak6 UTSW 2 118693912 missense probably damaging 1.00
R7232:Pak6 UTSW 2 118693522 missense probably damaging 0.96
R7236:Pak6 UTSW 2 118693428 missense probably benign 0.26
R7292:Pak6 UTSW 2 118693591 missense possibly damaging 0.95
R7623:Pak6 UTSW 2 118694587 missense probably damaging 1.00
R7823:Pak6 UTSW 2 118695312 missense probably benign 0.02
R8190:Pak6 UTSW 2 118690097 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAATGAGGCTTGCACGG -3'
(R):5'- GGGCAAAGGGACTACAACTC -3'

Sequencing Primer
(F):5'- ACCATGGGATGCTGTGC -3'
(R):5'- GGACTACAACTCCCAGGCTG -3'
Posted On2014-12-29