Incidental Mutation 'R2920:Clca3b'
ID 255456
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Name chloride channel accessory 3B
Synonyms Clca4
MMRRC Submission 040505-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144528384-144555063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144543614 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 405 (D405V)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
AlphaFold E9PUL3
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: D405V

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: D405V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,265,987 (GRCm39) Y1025H probably damaging Het
Adgrv1 C T 13: 81,596,984 (GRCm39) A4122T probably benign Het
Aloxe3 C T 11: 69,033,749 (GRCm39) T621I probably damaging Het
Atp2b3 A C X: 72,577,526 (GRCm39) T318P probably benign Het
Atrx A T X: 104,874,474 (GRCm39) V1962D probably benign Het
Chl1 C A 6: 103,672,304 (GRCm39) T531K probably damaging Het
Comtd1 A G 14: 21,897,686 (GRCm39) L149P possibly damaging Het
Cops7a A G 6: 124,939,325 (GRCm39) V108A probably benign Het
Crebbp A G 16: 3,936,946 (GRCm39) V343A probably damaging Het
Edrf1 T A 7: 133,269,301 (GRCm39) D1109E probably benign Het
Elmo3 A G 8: 106,034,691 (GRCm39) E359G possibly damaging Het
Ep400 C A 5: 110,903,780 (GRCm39) G273V probably damaging Het
Fgfr3 A G 5: 33,891,284 (GRCm39) N516S probably damaging Het
Glb1l T A 1: 75,185,834 (GRCm39) E31D probably benign Het
Hdac1-ps A G 17: 78,800,275 (GRCm39) D422G probably damaging Het
Il12rb2 C T 6: 67,337,552 (GRCm39) V110I probably damaging Het
Ints3 T C 3: 90,300,469 (GRCm39) E884G probably benign Het
Lin7b A G 7: 45,017,821 (GRCm39) V170A possibly damaging Het
Lrch2 A T X: 146,256,026 (GRCm39) V750E probably damaging Het
Mepe C T 5: 104,486,113 (GRCm39) R418C probably damaging Het
Mettl25 A T 10: 105,601,038 (GRCm39) probably null Het
Mphosph9 G A 5: 124,399,069 (GRCm39) T982I probably benign Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myo10 G T 15: 25,801,226 (GRCm39) V1472L probably damaging Het
Myo9b A G 8: 71,778,501 (GRCm39) K445R probably damaging Het
Ntng2 T C 2: 29,094,223 (GRCm39) M383V probably benign Het
Or13n4 C T 7: 106,423,571 (GRCm39) R54Q probably benign Het
Or2z2 T C 11: 58,346,403 (GRCm39) Y124C probably damaging Het
Or7a37 A C 10: 78,805,846 (GRCm39) D121A probably damaging Het
Pak6 A T 2: 118,524,488 (GRCm39) probably benign Het
Pcdh8 G T 14: 80,006,154 (GRCm39) P803Q possibly damaging Het
Pfkfb3 C T 2: 11,489,138 (GRCm39) V286I probably benign Het
Rbp3 C T 14: 33,677,975 (GRCm39) T641M probably damaging Het
Rint1 A G 5: 24,010,400 (GRCm39) E203G probably benign Het
Sdf2 G C 11: 78,145,680 (GRCm39) V126L probably damaging Het
Slc13a5 T C 11: 72,138,617 (GRCm39) E442G possibly damaging Het
Slc14a2 G T 18: 78,201,512 (GRCm39) S669* probably null Het
Slc38a7 A G 8: 96,572,571 (GRCm39) I157T possibly damaging Het
Slc4a5 T C 6: 83,241,369 (GRCm39) L215P probably damaging Het
Tbc1d9 T C 8: 83,937,098 (GRCm39) V60A probably benign Het
Tcerg1l T C 7: 137,850,108 (GRCm39) R422G probably damaging Het
Tmem107 T C 11: 68,962,247 (GRCm39) L68P probably damaging Het
Ugt2b5 A G 5: 87,273,266 (GRCm39) F467L possibly damaging Het
Vmn1r19 A T 6: 57,381,909 (GRCm39) N154I probably benign Het
Vmn2r69 T A 7: 85,060,973 (GRCm39) I204L probably benign Het
Zbtb1 T A 12: 76,432,619 (GRCm39) S202T possibly damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144,542,393 (GRCm39) missense probably damaging 0.96
IGL00425:Clca3b APN 3 144,542,342 (GRCm39) missense probably benign 0.14
IGL00725:Clca3b APN 3 144,544,923 (GRCm39) missense probably benign 0.01
IGL00898:Clca3b APN 3 144,550,389 (GRCm39) splice site probably benign
IGL00953:Clca3b APN 3 144,552,972 (GRCm39) nonsense probably null
IGL01089:Clca3b APN 3 144,529,283 (GRCm39) missense probably benign
IGL01376:Clca3b APN 3 144,531,812 (GRCm39) missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144,554,924 (GRCm39) missense probably benign 0.04
IGL02022:Clca3b APN 3 144,547,171 (GRCm39) critical splice donor site probably null
IGL02200:Clca3b APN 3 144,547,190 (GRCm39) missense probably damaging 1.00
IGL02314:Clca3b APN 3 144,533,903 (GRCm39) splice site probably benign
IGL02331:Clca3b APN 3 144,547,167 (GRCm39) splice site probably benign
IGL02429:Clca3b APN 3 144,533,896 (GRCm39) missense probably damaging 1.00
IGL02868:Clca3b APN 3 144,533,325 (GRCm39) missense probably damaging 1.00
IGL03095:Clca3b APN 3 144,552,671 (GRCm39) nonsense probably null
IGL03331:Clca3b APN 3 144,533,724 (GRCm39) missense probably benign
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0506:Clca3b UTSW 3 144,528,627 (GRCm39) unclassified probably benign
R0524:Clca3b UTSW 3 144,531,082 (GRCm39) missense probably benign
R0637:Clca3b UTSW 3 144,533,701 (GRCm39) missense probably benign 0.03
R1577:Clca3b UTSW 3 144,529,280 (GRCm39) missense probably damaging 1.00
R1641:Clca3b UTSW 3 144,529,274 (GRCm39) missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144,543,585 (GRCm39) missense probably damaging 1.00
R2240:Clca3b UTSW 3 144,531,696 (GRCm39) missense probably benign 0.22
R2248:Clca3b UTSW 3 144,530,980 (GRCm39) missense probably benign 0.01
R2259:Clca3b UTSW 3 144,552,142 (GRCm39) missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144,552,692 (GRCm39) missense probably benign 0.01
R4355:Clca3b UTSW 3 144,531,219 (GRCm39) splice site probably null
R4691:Clca3b UTSW 3 144,544,853 (GRCm39) missense probably benign 0.02
R4828:Clca3b UTSW 3 144,550,273 (GRCm39) missense probably benign 0.02
R4845:Clca3b UTSW 3 144,531,031 (GRCm39) missense probably benign
R5182:Clca3b UTSW 3 144,533,776 (GRCm39) missense probably damaging 0.99
R5396:Clca3b UTSW 3 144,552,932 (GRCm39) missense probably damaging 0.99
R5429:Clca3b UTSW 3 144,552,220 (GRCm39) missense probably damaging 1.00
R5572:Clca3b UTSW 3 144,533,070 (GRCm39) missense probably damaging 1.00
R5657:Clca3b UTSW 3 144,533,144 (GRCm39) missense probably benign 0.25
R5845:Clca3b UTSW 3 144,531,077 (GRCm39) missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144,531,020 (GRCm39) missense probably benign 0.18
R6677:Clca3b UTSW 3 144,529,145 (GRCm39) missense probably benign 0.13
R6707:Clca3b UTSW 3 144,550,288 (GRCm39) missense probably benign 0.00
R7001:Clca3b UTSW 3 144,533,733 (GRCm39) missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144,543,519 (GRCm39) missense probably benign 0.00
R7323:Clca3b UTSW 3 144,531,681 (GRCm39) missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144,547,181 (GRCm39) missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144,542,417 (GRCm39) nonsense probably null
R7403:Clca3b UTSW 3 144,529,259 (GRCm39) missense probably benign 0.00
R7798:Clca3b UTSW 3 144,533,891 (GRCm39) missense probably damaging 1.00
R8008:Clca3b UTSW 3 144,550,370 (GRCm39) missense probably benign 0.44
R8132:Clca3b UTSW 3 144,552,935 (GRCm39) missense probably benign 0.13
R8181:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8305:Clca3b UTSW 3 144,531,698 (GRCm39) missense probably damaging 1.00
R8546:Clca3b UTSW 3 144,533,158 (GRCm39) missense probably damaging 0.99
R8716:Clca3b UTSW 3 144,550,355 (GRCm39) missense probably benign 0.14
R8804:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8966:Clca3b UTSW 3 144,544,872 (GRCm39) missense probably benign 0.27
R9003:Clca3b UTSW 3 144,533,072 (GRCm39) nonsense probably null
R9455:Clca3b UTSW 3 144,529,023 (GRCm39) missense unknown
R9470:Clca3b UTSW 3 144,543,456 (GRCm39) missense probably damaging 1.00
R9658:Clca3b UTSW 3 144,543,575 (GRCm39) missense probably damaging 0.98
R9760:Clca3b UTSW 3 144,552,610 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAGTTGTACCTGTCATGTCTG -3'
(R):5'- CGCATGCGTTAGATGACTAGG -3'

Sequencing Primer
(F):5'- CATGTCTGACAGAGTCTCCAG -3'
(R):5'- CATGCGTTAGATGACTAGGTCTATC -3'
Posted On 2014-12-29