Incidental Mutation 'R2920:Mepe'
ID 255461
Institutional Source Beutler Lab
Gene Symbol Mepe
Ensembl Gene ENSMUSG00000053863
Gene Name matrix extracellular phosphoglycoprotein with ASARM motif (bone)
Synonyms OF45
MMRRC Submission 040505-MU
Accession Numbers

Genbank: NM_053172; MGI: 2137384

Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R2920 (G1)
Quality Score 211
Status Validated
Chromosome 5
Chromosomal Location 104325329-104338611 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 104338247 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 418 (R418C)
Ref Sequence ENSEMBL: ENSMUSP00000065200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066207]
AlphaFold Q8K4L6
Predicted Effect probably damaging
Transcript: ENSMUST00000066207
AA Change: R418C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065200
Gene: ENSMUSG00000053863
AA Change: R418C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Osteoregulin 29 192 4.2e-76 PFAM
low complexity region 257 272 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have increased amounts of trabecular bone in their skeleton and undergo less age related bone loss. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Mepe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Mepe APN 5 104337977 missense probably damaging 1.00
IGL01896:Mepe APN 5 104338269 missense possibly damaging 0.85
IGL01997:Mepe APN 5 104337600 missense probably damaging 1.00
IGL02311:Mepe APN 5 104337705 missense probably damaging 0.98
IGL02586:Mepe APN 5 104337450 missense probably benign 0.39
F6893:Mepe UTSW 5 104337376 missense possibly damaging 0.87
R1187:Mepe UTSW 5 104338248 missense probably damaging 0.98
R1218:Mepe UTSW 5 104327073 missense probably benign
R1633:Mepe UTSW 5 104337674 missense probably benign 0.25
R2024:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2026:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2027:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2393:Mepe UTSW 5 104337461 missense possibly damaging 0.95
R3040:Mepe UTSW 5 104338122 missense probably damaging 0.99
R3716:Mepe UTSW 5 104337428 missense probably benign 0.25
R3973:Mepe UTSW 5 104337078 missense probably benign
R3976:Mepe UTSW 5 104337078 missense probably benign
R4894:Mepe UTSW 5 104325402 missense probably damaging 0.98
R5556:Mepe UTSW 5 104338212 missense probably damaging 1.00
R6256:Mepe UTSW 5 104337074 missense probably benign 0.01
R6788:Mepe UTSW 5 104338208 nonsense probably null
R7361:Mepe UTSW 5 104337143 missense probably benign 0.41
R8431:Mepe UTSW 5 104338181 missense possibly damaging 0.91
R8679:Mepe UTSW 5 104337888 missense possibly damaging 0.91
R8745:Mepe UTSW 5 104337659 missense possibly damaging 0.93
R8817:Mepe UTSW 5 104337285 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCAGCAAAGGTAGCTCTAGC -3'
(R):5'- TAGCACAATGTCCTGGAGGG -3'

Sequencing Primer
(F):5'- TTGACTGCAAGCCAAAGATTTCCAG -3'
(R):5'- GGACCAGGTCTGTTGGC -3'
Posted On 2014-12-29