Incidental Mutation 'R2920:Vmn1r19'
ID 255464
Institutional Source Beutler Lab
Gene Symbol Vmn1r19
Ensembl Gene ENSMUSG00000115799
Gene Name vomeronasal 1 receptor 19
Synonyms V1rc27
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 57403780-57406034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57404924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 154 (N154I)
Ref Sequence ENSEMBL: ENSMUSP00000087264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089830]
AlphaFold Q8R2C7
Predicted Effect probably benign
Transcript: ENSMUST00000089830
AA Change: N154I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000087264
Gene: ENSMUSG00000115799
AA Change: N154I

DomainStartEndE-ValueType
Pfam:V1R 28 293 6.6e-58 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Vmn1r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn1r19 APN 6 57405262 missense probably benign 0.03
IGL01287:Vmn1r19 APN 6 57405194 missense probably damaging 1.00
IGL01516:Vmn1r19 APN 6 57404872 missense probably benign 0.03
IGL01895:Vmn1r19 APN 6 57405260 missense probably benign 0.02
IGL02676:Vmn1r19 APN 6 57405040 missense possibly damaging 0.94
IGL03040:Vmn1r19 APN 6 57405362 missense unknown
IGL03087:Vmn1r19 APN 6 57404491 missense probably benign 0.01
PIT4802001:Vmn1r19 UTSW 6 57405052 missense probably damaging 1.00
R0319:Vmn1r19 UTSW 6 57404615 missense possibly damaging 0.93
R1368:Vmn1r19 UTSW 6 57404671 missense probably benign 0.01
R1997:Vmn1r19 UTSW 6 57405048 missense probably damaging 1.00
R3857:Vmn1r19 UTSW 6 57405113 missense possibly damaging 0.68
R4090:Vmn1r19 UTSW 6 57404735 missense probably damaging 1.00
R4547:Vmn1r19 UTSW 6 57404789 missense possibly damaging 0.56
R4823:Vmn1r19 UTSW 6 57405234 nonsense probably null
R4951:Vmn1r19 UTSW 6 57404942 missense probably benign 0.36
R5077:Vmn1r19 UTSW 6 57405041 missense probably benign 0.00
R5459:Vmn1r19 UTSW 6 57404490 nonsense probably null
R5625:Vmn1r19 UTSW 6 57405296 missense probably damaging 1.00
R5690:Vmn1r19 UTSW 6 57404795 missense probably benign 0.10
R5761:Vmn1r19 UTSW 6 57405353 missense unknown
R6124:Vmn1r19 UTSW 6 57404617 missense probably benign 0.02
R6373:Vmn1r19 UTSW 6 57405332 missense unknown
R6476:Vmn1r19 UTSW 6 57404593 missense probably damaging 0.99
R6938:Vmn1r19 UTSW 6 57405007 missense possibly damaging 0.94
R7027:Vmn1r19 UTSW 6 57404490 nonsense probably null
R7359:Vmn1r19 UTSW 6 57405095 missense probably damaging 0.99
R7568:Vmn1r19 UTSW 6 57404828 missense possibly damaging 0.69
R7893:Vmn1r19 UTSW 6 57404679 missense probably damaging 1.00
R8481:Vmn1r19 UTSW 6 57404947 missense probably damaging 0.99
R8487:Vmn1r19 UTSW 6 57405181 missense probably benign 0.03
R8812:Vmn1r19 UTSW 6 57404451 start gained probably benign
R8907:Vmn1r19 UTSW 6 57405006 missense probably benign
R8976:Vmn1r19 UTSW 6 57404734 missense probably benign 0.01
R9277:Vmn1r19 UTSW 6 57405337 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGTGTATCCCAGGCTATCAC -3'
(R):5'- CAAGATGTTTTGGGTGGCCC -3'

Sequencing Primer
(F):5'- GTGTATCCCAGGCTATCACAATCAG -3'
(R):5'- ATGCTATGAAGATGCTTGCATTGCC -3'
Posted On 2014-12-29