Mutagenetix > Incidental Mutation

Incidental Mutation 'R2920:Chl1'

255467

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

MMRRC Submission

040505-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.384) question?

Stock #

R2920 (G1)

Quality Score

213

Status

Validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 103695343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 531 (T531K)

Ref Sequence

ENSEMBL: ENSMUSP00000145026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]

AlphaFold

P70232

Predicted Effect

probably damaging
Transcript: ENSMUST00000066905
AA Change: T515K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: T515K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203830
AA Change: T515K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: T515K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203912
AA Change: T531K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: T531K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205098

SMART Domains

Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
FN3	4	67	4.4e-1	SMART
FN3	83	174	1.2e-3	SMART
FN3	189	275	2.1e-9	SMART
transmembrane domain	301	323	N/A	INTRINSIC
Pfam:Bravo_FIGEY	324	409	3.6e-30	PFAM

Meta Mutation Damage Score

0.6341

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	G	10: 10,390,243	Y1025H	probably damaging	Het
Adgrv1	C	T	13: 81,448,865	A4122T	probably benign	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Atp2b3	A	C	X: 73,533,920	T318P	probably benign	Het
Atrx	A	T	X: 105,830,868	V1962D	probably benign	Het
Clca3b	T	A	3: 144,837,853	D405V	probably benign	Het
Clca3b	C	T	3: 144,846,931	D115N	probably benign	Het
Comtd1	A	G	14: 21,847,618	L149P	possibly damaging	Het
Cops7a	A	G	6: 124,962,362	V108A	probably benign	Het
Crebbp	A	G	16: 4,119,082	V343A	probably damaging	Het
Edrf1	T	A	7: 133,667,572	D1109E	probably benign	Het
Elmo3	A	G	8: 105,308,059	E359G	possibly damaging	Het
Ep400	C	A	5: 110,755,914	G273V	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Glb1l	T	A	1: 75,209,190	E31D	probably benign	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Il12rb2	C	T	6: 67,360,568	V110I	probably damaging	Het
Ints3	T	C	3: 90,393,162	E884G	probably benign	Het
Lin7b	A	G	7: 45,368,397	V170A	possibly damaging	Het
Lrch2	A	T	X: 147,473,030	V750E	probably damaging	Het
Mepe	C	T	5: 104,338,247	R418C	probably damaging	Het
Mettl25	A	T	10: 105,765,177		probably null	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myo10	G	T	15: 25,801,140	V1472L	probably damaging	Het
Myo9b	A	G	8: 71,325,857	K445R	probably damaging	Het
Ntng2	T	C	2: 29,204,211	M383V	probably benign	Het
Olfr1353	A	C	10: 78,970,012	D121A	probably damaging	Het
Olfr30	T	C	11: 58,455,577	Y124C	probably damaging	Het
Olfr702	C	T	7: 106,824,364	R54Q	probably benign	Het
Pak6	A	T	2: 118,694,007		probably benign	Het
Pcdh8	G	T	14: 79,768,714	P803Q	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rint1	A	G	5: 23,805,402	E203G	probably benign	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc14a2	G	T	18: 78,158,297	S669*	probably null	Het
Slc38a7	A	G	8: 95,845,943	I157T	possibly damaging	Het
Slc4a5	T	C	6: 83,264,387	L215P	probably damaging	Het
Tbc1d9	T	C	8: 83,210,469	V60A	probably benign	Het
Tcerg1l	T	C	7: 138,248,379	R422G	probably damaging	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Vmn1r19	A	T	6: 57,404,924	N154I	probably benign	Het
Vmn2r69	T	A	7: 85,411,765	I204L	probably benign	Het
Zbtb1	T	A	12: 76,385,845	S202T	possibly damaging	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0685:Chl1	UTSW	6	103708542	splice site	probably null
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	splice site	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2291:Chl1	UTSW	6	103715393	missense	probably damaging	1.00
R3611:Chl1	UTSW	6	103698155	missense	probably damaging	1.00
R3979:Chl1	UTSW	6	103715284	nonsense	probably null
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6179:Chl1	UTSW	6	103683243	missense	probably benign	0.38
R6366:Chl1	UTSW	6	103729236	missense	possibly damaging	0.95
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94
R7838:Chl1	UTSW	6	103691674	missense	probably benign	0.01
R7863:Chl1	UTSW	6	103706514	missense	possibly damaging	0.46
R7874:Chl1	UTSW	6	103690263	missense	probably benign	0.22
R7998:Chl1	UTSW	6	103729289	missense	probably benign	0.01
R8044:Chl1	UTSW	6	103706632	missense	probably damaging	0.96
R8059:Chl1	UTSW	6	103674987	missense	probably damaging	0.97
R8462:Chl1	UTSW	6	103729169	missense	probably benign	0.11
R8558:Chl1	UTSW	6	103708429	missense	probably benign	0.14
R8827:Chl1	UTSW	6	103693150	missense	probably benign
R8865:Chl1	UTSW	6	103708861	missense	probably damaging	0.99
R8939:Chl1	UTSW	6	103665907	missense	probably damaging	1.00
R9092:Chl1	UTSW	6	103668854	unclassified	probably benign
Z1177:Chl1	UTSW	6	103693096	nonsense	probably null
Z1177:Chl1	UTSW	6	103697949	start gained	probably benign
Z1191:Chl1	UTSW	6	103683211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGCATGCACTTAAATTTTCTCGG -3'
(R):5'- AGGACCACTTCTCTAATGTGATC -3'

Sequencing Primer
(F):5'- TCTCGGGTTCAATGGTAGAATATAG -3'
(R):5'- CACACGTCTTTTCACAGCAG -3'

Posted On

2014-12-29