Incidental Mutation 'R2920:Cops7a'
ID 255468
Institutional Source Beutler Lab
Gene Symbol Cops7a
Ensembl Gene ENSMUSG00000030127
Gene Name COP9 signalosome subunit 7A
Synonyms COP9 complex S7a, D6Ertd35e
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 124958413-124965538 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124962362 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 108 (V108A)
Ref Sequence ENSEMBL: ENSMUSP00000114420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032220] [ENSMUST00000112439] [ENSMUST00000129446] [ENSMUST00000129976] [ENSMUST00000148485]
AlphaFold Q9CZ04
Predicted Effect probably benign
Transcript: ENSMUST00000032220
AA Change: V108A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032220
Gene: ENSMUSG00000030127
AA Change: V108A

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 177 2.65e-18 SMART
coiled coil region 197 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083831
Predicted Effect probably benign
Transcript: ENSMUST00000112439
AA Change: V108A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108058
Gene: ENSMUSG00000030127
AA Change: V108A

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 177 2.65e-18 SMART
coiled coil region 197 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129446
AA Change: V108A

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114420
Gene: ENSMUSG00000030127
AA Change: V108A

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 176 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129976
AA Change: V108A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117584
Gene: ENSMUSG00000030127
AA Change: V108A

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 177 2.65e-18 SMART
coiled coil region 197 222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135645
Predicted Effect probably benign
Transcript: ENSMUST00000148485
SMART Domains Protein: ENSMUSP00000115348
Gene: ENSMUSG00000030127

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Blast:PINT 31 77 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149346
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the COP9 signalosome, an evolutionarily conserved multi-subunit protease that regulates the activity of the ubiquitin conjugation pathway. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Cops7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Cops7a APN 6 124962416 missense probably benign 0.00
rubric UTSW 6 124960176 missense probably damaging 1.00
H8562:Cops7a UTSW 6 124962453 unclassified probably benign
R0139:Cops7a UTSW 6 124961360 missense probably damaging 0.98
R0242:Cops7a UTSW 6 124964854 missense probably benign 0.00
R0242:Cops7a UTSW 6 124964854 missense probably benign 0.00
R1121:Cops7a UTSW 6 124962416 missense probably benign 0.00
R1662:Cops7a UTSW 6 124962438 missense probably damaging 0.96
R1935:Cops7a UTSW 6 124962396 nonsense probably null
R3796:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R3797:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R3799:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R3854:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R5034:Cops7a UTSW 6 124962620 splice site probably null
R5858:Cops7a UTSW 6 124960171 missense possibly damaging 0.82
R6477:Cops7a UTSW 6 124960176 missense probably damaging 1.00
R6879:Cops7a UTSW 6 124958785 splice site probably null
R8906:Cops7a UTSW 6 124962408 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CATCTGATGAATGAGCCGGC -3'
(R):5'- TGAACCTCTGCAGTGTTAGACC -3'

Sequencing Primer
(F):5'- GGCTATTTTTACCCCAATCACAAAAG -3'
(R):5'- CCTCTGCAGTGTTAGACCATAATTG -3'
Posted On 2014-12-29