Incidental Mutation 'R2920:Lin7b'
ID 255470
Institutional Source Beutler Lab
Gene Symbol Lin7b
Ensembl Gene ENSMUSG00000003872
Gene Name lin-7 homolog B (C. elegans)
Synonyms LIN-7B, Veli2, MALS-2
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45367891-45370583 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45368397 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 170 (V170A)
Ref Sequence ENSEMBL: ENSMUSP00000003971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000003971] [ENSMUST00000210865] [ENSMUST00000211067]
AlphaFold O88951
PDB Structure Solution Structure of mLin-2/mLin-7 L27 Domain Complex [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000003961
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000003971
AA Change: V170A

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003971
Gene: ENSMUSG00000003872
AA Change: V170A

DomainStartEndE-ValueType
L27 13 68 1.96e-12 SMART
low complexity region 71 84 N/A INTRINSIC
PDZ 101 175 6.16e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124128
AA Change: V69A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210586
Predicted Effect probably benign
Transcript: ENSMUST00000210865
Predicted Effect probably benign
Transcript: ENSMUST00000211067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211463
Meta Mutation Damage Score 0.3085 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Lin7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Lin7b APN 7 45369200 missense probably damaging 1.00
R0539:Lin7b UTSW 7 45369902 unclassified probably benign
R1730:Lin7b UTSW 7 45369927 missense probably benign
R1783:Lin7b UTSW 7 45369927 missense probably benign
R2330:Lin7b UTSW 7 45369913 critical splice donor site probably null
R5646:Lin7b UTSW 7 45369193 missense probably damaging 0.96
R7155:Lin7b UTSW 7 45370227 missense probably damaging 0.99
R7487:Lin7b UTSW 7 45369940 missense possibly damaging 0.81
R7576:Lin7b UTSW 7 45369225 nonsense probably null
R7603:Lin7b UTSW 7 45368432 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAATGTTGAAGGCCGCTGTG -3'
(R):5'- TGCCTAAAGTTGGTGATCCAC -3'

Sequencing Primer
(F):5'- GCTCACTGGCCTGATTTGG -3'
(R):5'- TGCCTAAAGTTGGTGATCCACTAGAG -3'
Posted On 2014-12-29