Incidental Mutation 'R2920:Vmn2r69'
ID 255471
Institutional Source Beutler Lab
Gene Symbol Vmn2r69
Ensembl Gene ENSMUSG00000091006
Gene Name vomeronasal 2, receptor 69
Synonyms
MMRRC Submission 040505-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 85404849-85417476 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85411765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 204 (I204L)
Ref Sequence ENSEMBL: ENSMUSP00000132726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171213]
AlphaFold G3XA45
Predicted Effect probably benign
Transcript: ENSMUST00000171213
AA Change: I204L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132726
Gene: ENSMUSG00000091006
AA Change: I204L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.3e-28 PFAM
Pfam:NCD3G 507 559 1.8e-20 PFAM
Pfam:7tm_3 592 827 3.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207880
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Vmn2r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r69 APN 7 85406531 missense probably benign
IGL01457:Vmn2r69 APN 7 85406628 missense possibly damaging 0.87
IGL01760:Vmn2r69 APN 7 85406864 missense possibly damaging 0.90
IGL01834:Vmn2r69 APN 7 85412368 missense probably damaging 1.00
IGL02001:Vmn2r69 APN 7 85407226 missense probably benign 0.05
IGL02057:Vmn2r69 APN 7 85411782 missense possibly damaging 0.93
IGL02289:Vmn2r69 APN 7 85406846 missense probably damaging 1.00
IGL02472:Vmn2r69 APN 7 85409752 missense probably benign 0.01
IGL02478:Vmn2r69 APN 7 85406681 missense probably damaging 1.00
IGL02554:Vmn2r69 APN 7 85409806 missense probably damaging 1.00
IGL02723:Vmn2r69 APN 7 85410208 missense probably damaging 1.00
R0526:Vmn2r69 UTSW 7 85411503 missense probably damaging 1.00
R0560:Vmn2r69 UTSW 7 85409714 critical splice donor site probably null
R0909:Vmn2r69 UTSW 7 85406665 missense probably benign 0.00
R0976:Vmn2r69 UTSW 7 85406900 missense probably damaging 1.00
R1158:Vmn2r69 UTSW 7 85409850 splice site probably benign
R1459:Vmn2r69 UTSW 7 85406700 nonsense probably null
R1482:Vmn2r69 UTSW 7 85406874 missense probably damaging 1.00
R1917:Vmn2r69 UTSW 7 85411683 missense probably damaging 1.00
R2016:Vmn2r69 UTSW 7 85407285 missense probably damaging 0.98
R2108:Vmn2r69 UTSW 7 85410196 missense probably benign
R2571:Vmn2r69 UTSW 7 85415556 missense probably benign
R2910:Vmn2r69 UTSW 7 85406710 missense probably damaging 1.00
R3708:Vmn2r69 UTSW 7 85411821 missense probably damaging 0.98
R3710:Vmn2r69 UTSW 7 85406393 missense probably benign
R4757:Vmn2r69 UTSW 7 85412367 missense probably damaging 0.99
R4823:Vmn2r69 UTSW 7 85411300 missense probably benign 0.21
R4870:Vmn2r69 UTSW 7 85411585 missense possibly damaging 0.93
R4918:Vmn2r69 UTSW 7 85406759 missense probably benign 0.06
R5022:Vmn2r69 UTSW 7 85411159 missense possibly damaging 0.72
R5174:Vmn2r69 UTSW 7 85415531 missense possibly damaging 0.92
R5200:Vmn2r69 UTSW 7 85406509 missense probably damaging 1.00
R5278:Vmn2r69 UTSW 7 85411783 missense probably benign 0.02
R5643:Vmn2r69 UTSW 7 85407196 missense probably damaging 0.98
R5996:Vmn2r69 UTSW 7 85411909 splice site probably null
R6083:Vmn2r69 UTSW 7 85406503 missense probably damaging 1.00
R6140:Vmn2r69 UTSW 7 85411449 missense probably damaging 0.99
R6306:Vmn2r69 UTSW 7 85415591 missense probably benign 0.04
R6330:Vmn2r69 UTSW 7 85411627 missense probably benign
R6380:Vmn2r69 UTSW 7 85411859 missense probably benign
R6466:Vmn2r69 UTSW 7 85407170 missense probably benign 0.01
R6542:Vmn2r69 UTSW 7 85411205 nonsense probably null
R6583:Vmn2r69 UTSW 7 85409809 missense probably benign
R6623:Vmn2r69 UTSW 7 85407101 missense possibly damaging 0.84
R6709:Vmn2r69 UTSW 7 85411861 missense probably benign 0.03
R6732:Vmn2r69 UTSW 7 85411143 missense probably benign 0.00
R6741:Vmn2r69 UTSW 7 85412516 missense probably benign 0.01
R7070:Vmn2r69 UTSW 7 85411480 missense probably damaging 0.98
R7234:Vmn2r69 UTSW 7 85407107 missense probably benign 0.22
R7323:Vmn2r69 UTSW 7 85411764 missense possibly damaging 0.95
R7427:Vmn2r69 UTSW 7 85411259 missense probably benign 0.28
R7428:Vmn2r69 UTSW 7 85411259 missense probably benign 0.28
R7453:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7532:Vmn2r69 UTSW 7 85410414 missense probably benign 0.36
R7556:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7562:Vmn2r69 UTSW 7 85407212 missense probably benign
R7592:Vmn2r69 UTSW 7 85411560 frame shift probably null
R7708:Vmn2r69 UTSW 7 85412547 missense possibly damaging 0.87
R7803:Vmn2r69 UTSW 7 85407116 missense probably benign 0.00
R7960:Vmn2r69 UTSW 7 85406765 missense probably benign
R7966:Vmn2r69 UTSW 7 85411554 missense possibly damaging 0.81
R8071:Vmn2r69 UTSW 7 85406505 nonsense probably null
R8237:Vmn2r69 UTSW 7 85411132 missense probably benign 0.02
R8347:Vmn2r69 UTSW 7 85415630 missense probably benign 0.00
R8737:Vmn2r69 UTSW 7 85406575 missense probably damaging 1.00
R8795:Vmn2r69 UTSW 7 85415675 start codon destroyed probably null 0.94
R8831:Vmn2r69 UTSW 7 85409810 nonsense probably null
R8856:Vmn2r69 UTSW 7 85412455 missense probably benign 0.00
R8998:Vmn2r69 UTSW 7 85411099 missense probably benign 0.33
R8999:Vmn2r69 UTSW 7 85411099 missense probably benign 0.33
R9161:Vmn2r69 UTSW 7 85406969 missense possibly damaging 0.88
R9228:Vmn2r69 UTSW 7 85415489 missense probably benign 0.01
R9494:Vmn2r69 UTSW 7 85406876 missense probably benign 0.08
R9494:Vmn2r69 UTSW 7 85411560 missense probably damaging 1.00
R9541:Vmn2r69 UTSW 7 85407001 missense probably benign
R9620:Vmn2r69 UTSW 7 85412296 missense probably benign 0.10
Z1176:Vmn2r69 UTSW 7 85406488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATATCCACAATGTGAGGGC -3'
(R):5'- GCAGTCCATCATGTTCATATTATTGCC -3'

Sequencing Primer
(F):5'- CCACAATGTGAGGGCATAATTTATGG -3'
(R):5'- ATTGCCTATGTACTGTATTTTTCAGC -3'
Posted On 2014-12-29