Incidental Mutation 'R2920:Olfr702'
ID 255472
Institutional Source Beutler Lab
Gene Symbol Olfr702
Ensembl Gene ENSMUSG00000056863
Gene Name olfactory receptor 702
Synonyms MOR260-4, GA_x6K02T2PBJ9-9202245-9201289
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 106823489-106833893 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 106824364 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 54 (R54Q)
Ref Sequence ENSEMBL: ENSMUSP00000146445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075414] [ENSMUST00000080899] [ENSMUST00000208864] [ENSMUST00000208895] [ENSMUST00000217739] [ENSMUST00000219803]
AlphaFold Q920Z2
Predicted Effect probably benign
Transcript: ENSMUST00000075414
SMART Domains Protein: ENSMUSP00000074868
Gene: ENSMUSG00000036744

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-46 PFAM
Pfam:7tm_1 41 290 2.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080899
AA Change: R54Q

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079704
Gene: ENSMUSG00000056863
AA Change: R54Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 300 2.9e-8 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208864
AA Change: R54Q

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000208895
AA Change: R54Q

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000217739
Predicted Effect probably benign
Transcript: ENSMUST00000219803
AA Change: R54Q

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Olfr702
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Olfr702 APN 7 106824029 missense probably benign 0.01
IGL02120:Olfr702 APN 7 106823698 missense possibly damaging 0.94
R0025:Olfr702 UTSW 7 106823756 missense possibly damaging 0.74
R1213:Olfr702 UTSW 7 106824197 missense possibly damaging 0.48
R1830:Olfr702 UTSW 7 106824110 missense probably benign 0.00
R2216:Olfr702 UTSW 7 106823998 missense probably damaging 0.99
R2571:Olfr702 UTSW 7 106823726 missense probably benign 0.09
R2876:Olfr702 UTSW 7 106824457 missense probably benign 0.07
R4082:Olfr702 UTSW 7 106824038 missense possibly damaging 0.78
R4130:Olfr702 UTSW 7 106823585 missense probably benign 0.01
R4750:Olfr702 UTSW 7 106824307 missense probably damaging 0.98
R5007:Olfr702 UTSW 7 106824157 missense probably damaging 1.00
R5117:Olfr702 UTSW 7 106823662 missense probably damaging 0.99
R5908:Olfr702 UTSW 7 106824197 missense probably benign 0.09
R6824:Olfr702 UTSW 7 106824457 missense probably benign 0.00
R7193:Olfr702 UTSW 7 106824591 start gained probably benign
R7254:Olfr702 UTSW 7 106823570 makesense probably null
R7827:Olfr702 UTSW 7 106823725 missense probably benign 0.01
R8309:Olfr702 UTSW 7 106824413 missense probably benign 0.00
R8410:Olfr702 UTSW 7 106824538 start gained probably benign
R9353:Olfr702 UTSW 7 106823855 missense probably benign 0.00
R9386:Olfr702 UTSW 7 106824500 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGGTCATAGGACATAACTGC -3'
(R):5'- TCCTTCTGACAACAGGTAAACAG -3'

Sequencing Primer
(F):5'- GTCATAGGACATAACTGCCAGCAG -3'
(R):5'- CAGGAATAAATATCAATGGGAGGAG -3'
Posted On 2014-12-29