Incidental Mutation 'R2920:Edrf1'
ID255473
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Nameerythroid differentiation regulatory factor 1
Synonyms2700050L05Rik
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.642) question?
Stock #R2920 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location133637543-133672971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133667572 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1109 (D1109E)
Ref Sequence ENSEMBL: ENSMUSP00000115641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901]
Predicted Effect probably benign
Transcript: ENSMUST00000051169
AA Change: D1143E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990
AA Change: D1143E

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128901
AA Change: D1109E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990
AA Change: D1109E

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137338
Predicted Effect unknown
Transcript: ENSMUST00000176661
AA Change: D30E
SMART Domains Protein: ENSMUSP00000134967
Gene: ENSMUSG00000039990
AA Change: D30E

DomainStartEndE-ValueType
low complexity region 116 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211072
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133658553 nonsense probably null
IGL01637:Edrf1 APN 7 133650525 missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133643730 missense probably benign 0.02
IGL01893:Edrf1 APN 7 133657102 missense probably benign 0.09
IGL02202:Edrf1 APN 7 133656970 missense probably benign 0.00
IGL02278:Edrf1 APN 7 133657000 missense probably benign 0.00
IGL02382:Edrf1 APN 7 133650615 splice site probably benign
IGL02743:Edrf1 APN 7 133656491 unclassified probably benign
R0265:Edrf1 UTSW 7 133657045 missense probably damaging 1.00
R0282:Edrf1 UTSW 7 133644022 missense probably benign 0.21
R1167:Edrf1 UTSW 7 133644066 missense probably benign 0.08
R1633:Edrf1 UTSW 7 133652140 missense probably damaging 1.00
R2039:Edrf1 UTSW 7 133653949 nonsense probably null
R2060:Edrf1 UTSW 7 133657129 nonsense probably null
R4770:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133651044 missense probably benign 0.03
R5156:Edrf1 UTSW 7 133660179 missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133650566 missense probably damaging 0.98
R5342:Edrf1 UTSW 7 133651910 intron probably null
R5416:Edrf1 UTSW 7 133641402 missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133663415 missense probably benign
R6272:Edrf1 UTSW 7 133637808 start gained probably benign
R6275:Edrf1 UTSW 7 133667582 missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133637849 missense probably benign
R7244:Edrf1 UTSW 7 133654350 missense probably benign 0.01
R7716:Edrf1 UTSW 7 133643726 missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133661877 missense possibly damaging 0.95
R8197:Edrf1 UTSW 7 133647359 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GGCCTTACTGTATCTTTATCAGGGAG -3'
(R):5'- GCAGTAGGCACATGGTCATG -3'

Sequencing Primer
(F):5'- ACTGTATCTTTATCAGGGAGCTTTTG -3'
(R):5'- GGATTGGAACTCAGGACCTTC -3'
Posted On2014-12-29