Incidental Mutation 'R2920:Tcerg1l'
ID 255474
Institutional Source Beutler Lab
Gene Symbol Tcerg1l
Ensembl Gene ENSMUSG00000091002
Gene Name transcription elongation regulator 1-like
Synonyms 5730476P14Rik
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 138208974-138397730 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 138248379 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 422 (R422G)
Ref Sequence ENSEMBL: ENSMUSP00000124476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160436]
AlphaFold Q3B807
Predicted Effect probably damaging
Transcript: ENSMUST00000160436
AA Change: R422G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002
AA Change: R422G

DomainStartEndE-ValueType
low complexity region 6 44 N/A INTRINSIC
low complexity region 52 97 N/A INTRINSIC
WW 146 178 2.11e1 SMART
low complexity region 235 249 N/A INTRINSIC
WW 344 376 3.29e-4 SMART
low complexity region 402 415 N/A INTRINSIC
FF 454 507 4.57e-12 SMART
FF 520 574 1.53e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161213
Meta Mutation Damage Score 0.1021 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Tcerg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tcerg1l APN 7 138209804 missense probably damaging 0.99
IGL01402:Tcerg1l APN 7 138259839 missense probably damaging 0.98
IGL01510:Tcerg1l APN 7 138394305 splice site probably benign
IGL01638:Tcerg1l APN 7 138280076 missense probably damaging 1.00
IGL01710:Tcerg1l APN 7 138395060 missense possibly damaging 0.81
IGL02547:Tcerg1l APN 7 138248371 critical splice donor site probably null
IGL02887:Tcerg1l APN 7 138229890 missense probably damaging 1.00
IGL03105:Tcerg1l APN 7 138248444 splice site probably benign
IGL03348:Tcerg1l APN 7 138213371 missense probably damaging 0.97
R0378:Tcerg1l UTSW 7 138276655 missense probably benign 0.01
R1474:Tcerg1l UTSW 7 138280075 missense probably damaging 0.99
R1589:Tcerg1l UTSW 7 138361767 missense probably damaging 0.99
R1658:Tcerg1l UTSW 7 138394180 missense probably damaging 0.98
R1792:Tcerg1l UTSW 7 138361866 missense probably benign 0.07
R1807:Tcerg1l UTSW 7 138395097 missense probably benign 0.34
R3148:Tcerg1l UTSW 7 138259867 missense probably benign
R4106:Tcerg1l UTSW 7 138259944 missense probably damaging 0.99
R4180:Tcerg1l UTSW 7 138276676 critical splice acceptor site probably null
R4241:Tcerg1l UTSW 7 138397632 missense unknown
R4898:Tcerg1l UTSW 7 138218057 missense probably damaging 0.99
R5652:Tcerg1l UTSW 7 138280046 missense probably damaging 0.97
R6646:Tcerg1l UTSW 7 138395183 splice site probably null
R6824:Tcerg1l UTSW 7 138394115 critical splice donor site probably null
R7414:Tcerg1l UTSW 7 138218057 missense probably damaging 0.97
R7490:Tcerg1l UTSW 7 138259828 missense probably damaging 1.00
R8810:Tcerg1l UTSW 7 138209797 missense possibly damaging 0.79
R8889:Tcerg1l UTSW 7 138397531 nonsense probably null
R8892:Tcerg1l UTSW 7 138397531 nonsense probably null
R9146:Tcerg1l UTSW 7 138229859 missense probably damaging 1.00
R9374:Tcerg1l UTSW 7 138394269 missense possibly damaging 0.95
R9392:Tcerg1l UTSW 7 138213435 missense probably damaging 0.98
R9402:Tcerg1l UTSW 7 138209822 missense probably damaging 0.99
R9428:Tcerg1l UTSW 7 138209761 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATGGCCACTTCCACATGG -3'
(R):5'- CGAATGTAGGTGTCTAAGAGAAATCC -3'

Sequencing Primer
(F):5'- TTCCACATGGCTCTGGAAG -3'
(R):5'- GAAATCCAGTCAGTTTTCAGATGGGC -3'
Posted On 2014-12-29