Incidental Mutation 'R2920:Slc13a5'
ID255484
Institutional Source Beutler Lab
Gene Symbol Slc13a5
Ensembl Gene ENSMUSG00000020805
Gene Namesolute carrier family 13 (sodium-dependent citrate transporter), member 5
SynonymsIndy, Nact, mINDY, NaC2/NaCT
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2920 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72241989-72267222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72247791 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 442 (E442G)
Ref Sequence ENSEMBL: ENSMUSP00000021161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021161] [ENSMUST00000137701] [ENSMUST00000208056] [ENSMUST00000208912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021161
AA Change: E442G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021161
Gene: ENSMUSG00000020805
AA Change: E442G

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 8 558 1.3e-121 PFAM
Pfam:CitMHS 13 172 1.6e-14 PFAM
Pfam:CitMHS 202 498 6.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137701
AA Change: E442G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119417
Gene: ENSMUSG00000020805
AA Change: E442G

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 7 115 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208056
AA Change: E425G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208912
AA Change: E399G

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1002 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Slc13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Slc13a5 APN 11 72258954 splice site probably null
IGL03392:Slc13a5 APN 11 72245178 missense probably damaging 1.00
Punk UTSW 11 72262076 missense probably damaging 1.00
punk2 UTSW 11 72253391 missense possibly damaging 0.65
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0042:Slc13a5 UTSW 11 72259114 missense probably benign 0.31
R0194:Slc13a5 UTSW 11 72245233 missense probably benign 0.22
R0194:Slc13a5 UTSW 11 72262130 missense possibly damaging 0.95
R0234:Slc13a5 UTSW 11 72250800 missense probably damaging 0.98
R1499:Slc13a5 UTSW 11 72250731 missense probably damaging 0.97
R1655:Slc13a5 UTSW 11 72257378 missense probably benign 0.00
R1728:Slc13a5 UTSW 11 72266459 splice site probably null
R1818:Slc13a5 UTSW 11 72253343 missense probably benign 0.02
R2304:Slc13a5 UTSW 11 72259039 missense probably damaging 1.00
R2352:Slc13a5 UTSW 11 72252321 missense probably benign 0.06
R2408:Slc13a5 UTSW 11 72262076 missense probably damaging 1.00
R2919:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R3103:Slc13a5 UTSW 11 72257388 missense probably damaging 1.00
R4772:Slc13a5 UTSW 11 72250846 critical splice acceptor site probably null
R4906:Slc13a5 UTSW 11 72257418 missense probably damaging 0.99
R5385:Slc13a5 UTSW 11 72259077 missense probably benign 0.01
R5562:Slc13a5 UTSW 11 72262039 missense probably damaging 0.99
R5878:Slc13a5 UTSW 11 72253391 missense possibly damaging 0.65
R6173:Slc13a5 UTSW 11 72253197 missense probably benign 0.05
R6665:Slc13a5 UTSW 11 72260360 missense probably damaging 0.99
R7317:Slc13a5 UTSW 11 72245127 missense probably damaging 1.00
R7338:Slc13a5 UTSW 11 72266484 missense probably benign
R7908:Slc13a5 UTSW 11 72259064 missense probably benign 0.00
R7989:Slc13a5 UTSW 11 72259064 missense probably benign 0.00
R8038:Slc13a5 UTSW 11 72253370 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GCCATAGGTTCACAATTTCCCAC -3'
(R):5'- AGATCAGCTATGCCACAAGC -3'

Sequencing Primer
(F):5'- GGTTCACAATTTCCCACAAAATG -3'
(R):5'- ACATTGCAGGAGTCAAAAGATTAAG -3'
Posted On2014-12-29