Incidental Mutation 'R2920:Sdf2'
ID 255486
Institutional Source Beutler Lab
Gene Symbol Sdf2
Ensembl Gene ENSMUSG00000002064
Gene Name stromal cell derived factor 2
Synonyms
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 78245746-78255496 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 78254854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 126 (V126L)
Ref Sequence ENSEMBL: ENSMUSP00000002133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002133]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002133
AA Change: V126L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002133
Gene: ENSMUSG00000002064
AA Change: V126L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MIR 29 83 2.24e-11 SMART
MIR 91 146 5.47e-15 SMART
MIR 148 201 8.36e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154080
Meta Mutation Damage Score 0.6637 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is believed to be a secretory protein. It has regions of similarity to hydrophilic segments of yeast mannosyltransferases. Its expression is ubiquitous and the gene appears to be relatively conserved among mammals. Alternate splicing results in both coding and non-coding variants. A pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Sdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02423:Sdf2 APN 11 78251018 missense probably damaging 1.00
R1591:Sdf2 UTSW 11 78254993 missense probably damaging 0.96
R2919:Sdf2 UTSW 11 78254854 missense probably damaging 0.97
R4367:Sdf2 UTSW 11 78251037 missense probably damaging 1.00
R4371:Sdf2 UTSW 11 78251037 missense probably damaging 1.00
R5970:Sdf2 UTSW 11 78246080 missense probably benign
R7130:Sdf2 UTSW 11 78245997 start codon destroyed probably null
R7619:Sdf2 UTSW 11 78251163 missense probably damaging 0.99
R8868:Sdf2 UTSW 11 78246144 missense probably damaging 1.00
R8955:Sdf2 UTSW 11 78254937 missense probably benign 0.00
R9209:Sdf2 UTSW 11 78246032 missense unknown
Predicted Primers PCR Primer
(F):5'- GACCTAACCACCACATGTTGTTG -3'
(R):5'- TGGCCTTCCAGTAGTTGTTC -3'

Sequencing Primer
(F):5'- TGTAGCTGACTTCAGATGCACCAG -3'
(R):5'- GCTGGGCCATACCATGTAC -3'
Posted On 2014-12-29